Mature miRNA: hsa-miR-488-5p

Mature miRNA

miRNA Name hsa-miR-488-5p
Previous Name hsa-miR-488;hsa-miR-488*
miRNA Sequence 5' - cccagauaauggcacucucaa - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002804

Precursor miRNA

Precursor Name hsa-mir-488
Genomic Location chr1:177029363-177029445 (-); nearby genomic features
NCBI GENE ID 574441
miRBase ID MI0003123
Precursor Sequence 
    a      cu  c   u      a  c        guu
gaga ucaucu  cc aga aauggc cu ucaaacaa   u
|||| ||||||  || ||| |||||| || ||||||||    c
cucu aguaga  gg ucu uuaucg ga aguuuguu   c
    c      cu  u   -      -  a        aaa

References

  • MicroRNA-488: A miRNA with diverse roles and clinical applications in cancer and other human diseases. Yang J, Wang X, Hao W, Wang Y, Li Z, Han Q, Zhang C, Liu H. Biomed Pharmacother. 2023 Sep;165:115115.

  • miR-488-3p Represses Malignant Behaviors and Facilitates Autophagy of Osteosarcoma Cells by Targeting Neurensin-2. Yun C, Zhang J, Morigele. Curr Pharm Biotechnol. 2024;25(10):1264-1275.

  • Circular RNA circPOFUT1 enhances malignant phenotypes and autophagy-associated chemoresistance via sequestrating miR-488-3p to activate the PLAG1-ATG12 axis in gastric cancer. Luo M, Deng X, Chen Z, Hu Y. Cell Death Dis. 2023 Jan 9;14(1):10.

  • Tumor- and metastasis-promoting roles of miR-488 inhibition via HULC enhancement and EZH2-mediated p53 repression in gastric cancer. Yang D, Shi M, You Q, Zhang Y, Hu Z, Xu J, Cai Q, Zhu Z. Cell Biol Toxicol. 2023 Aug;39(4):1341-1358.

  • The NF-κB/miR-488/ERBB2 axis modulates pancreatic cancer cell malignancy and tumor growth through cell cycle signaling. Han D, Zhu S, Li X, Li Z, Huang H, Gao W, Liu Y, Zhu H, Yu X. Cancer Biol Ther. 2022 Dec 31;23(1):294-309.

  • [Down-regulation of miR-488 targeting to promote Jag1 expression inhibits hypoxia-reoxygenation myocardial H9c2 cell damage]. Zhao Y, Pei X, Liu Y, Xu Y, Peng M, Yang H. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2021 Dec 10;38(12):1199-1203.

  • LncRNACASC9 promotes proliferation, metastasis, and cell cycle inovarian carcinoma cells through cyclinG1/TP53/MMP7 signaling. Sun M, Chen Y, Liu X, Cui Y. Bioengineered. 2021 Dec;12(1):8006-8019.

  • Circular RNA hsa_circ_0000751 serves as a microRNA-488 sponge to suppress gastric cancer progression via ubiquinol-cytochrome c reductase core protein 2 regulation. Wang D, Su F, Feng M. Bioengineered. 2021 Dec;12(1):8793-8808.

  • MicroRNA-488 serves as a diagnostic marker for atherosclerosis and regulates the biological behavior of vascular smooth muscle cells. Li Z, Xu C, Sun D. Bioengineered. 2021 Dec;12(1):4092-4099.

  • LncRNA HOTAIR Influences the Growth, Migration, and Invasion of Papillary Thyroid Carcinoma via Affection on the miR-488-5p/NUP205 Axis. Xia F, Xia W, Yu X. Technol Cancer Res Treat. 2020 Jan-Dec;19:1533033820962125.

  • MicroRNA-488 inhibits proliferation and motility of tumor cells via downregulating FSCN1, modulated by Notch3 in breast carcinomas. Wu Y, Yuan MH, Wu HT, Chen WJ, Zhang ML, Ye QQ, Liu J, Zhang GJ. Cell Death Dis. 2020 Oct 24;11(10):912.

  • Downregulation of Long Noncoding RNA Myocardial Infarction Associated Transcript Suppresses Cell Proliferation, Migration, Invasion, and Glycolysis by Regulation of miR-488-3p/IGF1R Pathway in Colorectal Cancer. Liu Y, Peng H, Shen Y, Da R, Tian A, Guo X. Cancer Biother Radiopharm. 2022 Dec;37(10):927-938.

  • Mir-488 alleviates chemoresistance and glycolysis of colorectal cancer by targeting PFKFB3. Deng X, Li D, Ke X, Wang Q, Yan S, Xue Y, Wang Q, Zheng H. J Clin Lab Anal. 2021 Jan;35(1):e23578.

  • Higher Peripheral Blood MiR-488 Level Predicts Poor Prognosis of Acute Ischemic Stroke. Liang J, Zhang Z. Clin Lab. 2020 Jul 1;66(7).

  • MicroRNA-488 inhibits ovarian cancer cell metastasis through regulating CCNG1 and p53 expression. Guo JY, Wang XQ, Sun LF. Eur Rev Med Pharmacol Sci. 2020 Mar;24(6):2902-2910.

  • miR-488-5p and its role in melanoma. Arnold J, Engelmann JC, Schneider N, Bosserhoff AK, Kuphal S. Exp Mol Pathol. 2020 Feb;112:104348.

  • miR-488 mediates negative regulation of the AKT/NF-κB pathway by targeting Rac1 in LPS-induced inflammation. Liu J, Guo S, Jiang K, Zhang T, Zhiming W, Yaping Y, Jing Y, Shaukat A, Deng G. J Cell Physiol. 2020 May;235(5):4766-4777.

  • MicroRNA-488 inhibits proliferation and glycolysis in human prostate cancer cells by regulating PFKFB3. Wang J, Li X, Xiao Z, Wang Y, Han Y, Li J, Zhu W, Leng Q, Wen Y, Wen X. FEBS Open Bio. 2019 Oct;9(10):1798-1807.

  • LncRNA SNHG1 overexpression regulates the proliferation of acute myeloid leukemia cells through miR-488-5p/NUP205 axis. Bao XL, Zhang L, Song WP. Eur Rev Med Pharmacol Sci. 2019 Jul;23(13):5896-5903.

  • MicroRNA-488-3p inhibits proliferation and induces apoptosis by targeting ZBTB2 in esophageal squamous cell carcinoma. Yang Y, Li H, He Z, Xie D, Ni J, Lin X. J Cell Biochem. 2019 Nov;120(11):18702-18713.

    • There are 41 references associated with hsa-miR-488-5p. Click here to see the complete list in PubMed.