Mature miRNA: hsa-miR-486-3p

Mature miRNA

miRNA Name hsa-miR-486-3p
miRNA Sequence 5' - cggggcagcucaguacaggau - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004762

Precursor miRNA

Precursor Name hsa-mir-486-1
Genomic Location chr8:41660441-41660508 (-); nearby genomic features
Clustered miRNAs hsa-mir-486-1,hsa-mir-486-2 (within 10kb in genome)
NCBI GENE ID 619554
miRBase ID MI0002470
Precursor Sequence 
gc                      ----   ccuu
  auccuguacugagcugccccga    ggc    c
  ||||||||||||||||||||||    |||    
  uaggacaugacucgacggggcu    ccg    a
ca                      cgac   ucgu
Precursor Name hsa-mir-486-2
Genomic Location chr8:41660444-41660507 (+); nearby genomic features
Clustered miRNAs hsa-mir-486-1,hsa-mir-486-2 (within 10kb in genome)
NCBI GENE ID 102465696
miRBase ID MI0023622
Precursor Sequence 
--                      -  ggg a
  uccuguacugagcugccccgag cu   c g
  |||||||||||||||||||||| ||   |  c
  aggacaugacucgacggggcuc gg   g a
gu                      c  gaa u

References

  • Exosomes derived from adipose tissue-derived stem cells alleviated H Li Y, Xiao Y, Shang Y, Xu C, Han C, Hu D, Han J, Wang H. Cell Biol Toxicol. 2024 May 25;40(1):39.

  • LINC00606 promotes glioblastoma progression through sponge miR-486-3p and interaction with ATP11B. Dong N, Qi W, Wu L, Li J, Zhang X, Wu H, Zhang W, Jiang J, Zhang S, Fu W, Liu Q, Qi G, Wang L, Lu Y, Luo J, Kong Y, Liu Y, Zhao RC, Wang J. J Exp Clin Cancer Res. 2024 May 9;43(1):139.

  • Abnormal methylation mediated upregulation of LINC00857 boosts malignant progression of lung adenocarcinoma by modulating the miR-486-5p/NEK2 axis. Fu H, Zhang M, Liu X, Yang Y, Xing Y. Clin Respir J. 2024 May;18(5):e13765.

  • The Molecular Pathogenesis of Tumor-Suppressive Tomioka Y, Suetsugu T, Seki N, Tanigawa K, Hagihara Y, Shinmura M, Asai S, Kikkawa N, Inoue H, Mizuno K. Cells. 2023 Jul 18;12(14):1885.

  • Circ-STC2 promotes the ferroptosis of nucleus pulposus cells via targeting miR-486-3p/TFR2 axis. Xiong L, Li X, Hua X, Qian Z. J Orthop Surg Res. 2023 Jul 21;18(1):518.

  • miR-486-5p Attenuates Steroid-Induced Adipogenesis and Osteonecrosis of the Femoral Head Via TBX2/P21 Axis. Chen Y, Tang B, Jiang W, Sun M, Zhang H, Tao Y, Wang H, Xiang D, Bai H, Guo M, Zhao P, Yan W, Huang X, Chen T, Lian C, Zhang J. Stem Cells. 2023 Jul 14;41(7):711-723.

  • Downregulation of circ_0024028 inhibits IL-22-induced keratinocyte proliferation and migration by miR-486-3p/AKT3 axis. Zhang B, Wu S. Arch Dermatol Res. 2023 Sep;315(7):2079-2090.

  • MicroRNA-145 and microRNA-486 are potential serum biomarkers for vascular calcification. Fernández-Villabrille S, Martín-Carro B, Martín-Vírgala J, Alonso-Montes C, Palomo-Antequera C, García-Castro R, López-Ongil S, Dusso AS, Fernández-Martín JL, Naves-Díaz M, Cannata-Andía JB, Carrillo-López N, Panizo S. Nephrol Dial Transplant. 2023 Jun 30;38(7):1729-1740.

  • Role of m6A modification and novel circ_0066715/ miR-486-5p/ ETS1 axis in rheumatoid arthritis macrophage polarization progression. Wan L, Liu J, Huang C, Zhu Z, Li F, Sun G, Wang K, Li S, Ma X, Chen X, Yuan W. Aging (Albany NY). 2022 Dec 20;14(24):10009-10026.

  • Microrna-486-5P Regulates Human Pulmonary Artery Smooth Muscle Cell Migration via Endothelin-1. Yen TA, Huang HC, Wu ET, Chou HW, Chou HC, Chen CY, Huang SC, Chen YS, Lu F, Wu MH, Tsao PN, Wang CC. Int J Mol Sci. 2022 Sep 8;23(18):10400.

  • miR-486 improves fibrotic activity in myocardial infarction by targeting SRSF3/p21-Mediated cardiac myofibroblast senescence. Chen H, Lv L, Liang R, Guo W, Liao Z, Chen Y, Zhu K, Huang R, Zhao H, Pu Q, Yuan Z, Zeng Z, Zheng X, Feng S, Qi X, Cai D. J Cell Mol Med. 2022 Oct;26(20):5135-5149.

  • Long Non-Coding RNA LINC02802 Regulates In Vitro Sprouting Angiogenesis by Sponging microRNA-486-5p. Rosano S, Parab S, Noghero A, Corà D, Bussolino F. Int J Mol Sci. 2022 Jan 31;23(3):1653.

  • Long non-coding RNA (lncRNA) plasmacytoma variant translocation 1 gene (PVT1) modulates the proliferation and apoptosis of acute lymphoblastic leukemia cells by sponging miR-486-5p. Ju JK, Han WN, Shi CL. Bioengineered. 2022 Feb;13(2):4587-4597.

  • miR-486 attenuates cardiac ischemia/reperfusion injury and mediates the beneficial effect of exercise for myocardial protection. Bei Y, Lu D, Bär C, Chatterjee S, Costa A, Riedel I, Mooren FC, Zhu Y, Huang Z, Wei M, Hu M, Liu S, Yu P, Wang K, Thum T, Xiao J. Mol Ther. 2022 Apr 6;30(4):1675-1691.

  • MicroRNA-486-3p promotes the proliferation and metastasis of cutaneous squamous cell carcinoma by suppressing flotillin-2. Li X, Yuan Y, Wang Y, Xie K, Lu S, Chen F, Zhou M, Zhen P. J Dermatol Sci. 2022 Jan;105(1):18-26.

  • Medial tunica degeneration of the ascending aortic wall is associated with specific microRNA changes in bicuspid aortic valve disease. Pisano C, Gammazza AM, Rappa F, Barone R, Allegro R, Pitruzzella A, Tagliavia A, Agostara V, Ruvolo G, Cappello F, Argano V. Mol Med Rep. 2021 Dec;24(6):876.

  • Decreased exosome-delivered miR-486-5p is responsible for the peritoneal metastasis of gastric cancer cells by promoting EMT progress. Lin XM, Wang ZJ, Lin YX, Chen H. World J Surg Oncol. 2021 Oct 23;19(1):312.

  • Mesenchymal stem cell conditioned medium attenuates oxidative stress injury in hepatocytes partly by regulating the miR-486-5p/PIM1 axis and the TGF-β/Smad pathway. Ma N, Li S, Lin C, Cheng X, Meng Z. Bioengineered. 2021 Dec;12(1):6434-6447.

  • Serum microRNA-486-5p expression in obese Egyptian children and its possible association with fatty liver. Al Azzouny MA, Behiry EG, Behairy OG, Abd Ellraouf HA, Elfallah AA. Diabetes Metab Syndr. 2021 Sep-Oct;15(5):102258.

  • miR‑486‑5p suppresses gastric cancer cell growth and migration through downregulation of fibroblast growth factor 9. Wei W, Liu C, Yao R, Tan Q, Wang Q, Tian H. Mol Med Rep. 2021 Nov;24(5):771.

    • There are 127 references associated with hsa-miR-486-3p. Click here to see the complete list in PubMed.