Mature miRNA: hsa-miR-4739

Mature miRNA

miRNA Name hsa-miR-4739
miRNA Sequence 5' - aagggaggaggagcggaggggcccu - 3' (length = 25)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019868
Similar miRNAs hsa-miR-1321, hsa-miR-4756-5p (sharing the same seed sequence with hsa-miR-4739).

Precursor miRNA

Precursor Name hsa-mir-4739
Genomic Location chr17:79707176-79707249 (-); nearby genomic features
NCBI GENE ID 100616170
miRBase ID MI0017377
Precursor Sequence 
      aa  a         agc        c  u u
gggagg  ga gggaggagg   ggaggggc cu g c
||||||  || |||||||||   |||||||| || |  u
cccucc  cu cccuccuuc   ccucuccg ga c u
      cc  c         ---        a  c c

References

  • The miR-4739/DLX3 Axis Modulates Bone Marrow-Derived Mesenchymal Stem Cell (BMSC) Osteogenesis Affecting Osteoporosis Progression. Li D, Yuan Q, Xiong L, Li A, Xia Y. Front Endocrinol (Lausanne). 2021 Dec 2;12:703167.

  • Circular RNA Hsa_circ_0006766 targets microRNA miR-4739 to regulate osteogenic differentiation of human bone marrow mesenchymal stem cells. Guo Z, Xie M, Zou Y, Liang Q, Liu F, Su J, He Z, Cai X, Chen Z, Zhao Q, Zhao K. Bioengineered. 2021 Dec;12(1):5679-5687.

  • ZEB1 activated-VPS9D1-AS1 promotes the tumorigenesis and progression of prostate cancer by sponging miR-4739 to upregulate MEF2D. Wang X, Chen Q, Wang X, Li W, Yu G, Zhu Z, Zhang W. Biomed Pharmacother. 2020 Feb;122:109557.

  • miR-4739 mediates pleural fibrosis by targeting bone morphogenetic protein 7. Wang M, Xiong L, Jiang LJ, Lu YZ, Liu F, Song LJ, Xiang F, He XL, Yu F, Shuai SY, Ma WL, Ye H. EBioMedicine. 2019 Mar;41:670-682.

  • Circulating MicroRNA-4739 May Be a Potential Biomarker of Critical Limb Ischemia in Patients with Diabetes. Li JY, Cheng B, Wang XF, Wang ZJ, Zhang HM, Liu SF, Chen LS, Huang WJ, Liu J, Deng AP. Biomed Res Int. 2018 Nov 14;2018:4232794.

  • MicroRNA-4739 regulates osteogenic and adipocytic differentiation of immortalized human bone marrow stromal cells via targeting LRP3. Elsafadi M, Manikandan M, Alajez NM, Hamam R, Dawud RA, Aldahmash A, Iqbal Z, Alfayez M, Kassem M, Mahmood A. Stem Cell Res. 2017 Apr;20:94-104.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.