Mature miRNA: hsa-miR-4715-5p

Mature miRNA

miRNA Name hsa-miR-4715-5p
miRNA Sequence 5' - aaguuggcugcaguuaaggugg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019824

Precursor miRNA

Precursor Name hsa-mir-4715
Genomic Location chr15:25848747-25848825 (-); nearby genomic features
NCBI GENE ID 100616474
miRBase ID MI0017349
Precursor Sequence 
       gaa                      -ua   a
ggggaau   aguuggcugcaguuaagguggc   auc g
|||||||   ||||||||||||||||||||||   ||| 
ccccuua   uuaaccgacgucaauuccaccg   uag c
       auc                      ugg   u

References

  • The macrophage-associated microRNA-4715-3p / Gasdermin D axis potentially indicates fibrosis progression in nonalcoholic fatty liver disease: evidence from transcriptome and biological data. Chen S, Cai X, Liu Y, Shen Y, Guillot A, Tacke F, Tang L, Liu H. Bioengineered. 2022 May;13(5):11740-11751.

  • Long noncoding RNA LCAT1 functions as a ceRNA to regulate RAC1 function by sponging miR-4715-5p in lung cancer. Yang J, Qiu Q, Qian X, Yi J, Jiao Y, Yu M, Li X, Li J, Mi C, Zhang J, Lu B, Chen E, Liu P, Lu Y. Mol Cancer. 2019 Nov 29;18(1):171.

  • Epigenetic regulation of AURKA by miR-4715-3p in upper gastrointestinal cancers. Gomaa A, Peng D, Chen Z, Soutto M, Abouelezz K, Corvalan A, El-Rifai W. Sci Rep. 2019 Nov 18;9(1):16970.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.