Mature miRNA: hsa-miR-4687-5p

Mature miRNA

miRNA Name hsa-miR-4687-5p
miRNA Sequence 5' - cagcccuccucccgcacccaaa - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019774

Precursor miRNA

Precursor Name hsa-mir-4687
Genomic Location chr11:3856062-3856141 (+); nearby genomic features
NCBI GENE ID 100616453
miRBase ID MI0017319
Precursor Sequence 
     ag     a    u     c   c     cu g  g
accug  gagcc gccc ccucc gca ccaaa  u ga c
|||||  ||||| |||| ||||| ||| |||||  | || 
ugggc  cucgg cggg ggagg ugu gguuu  a uu a
     -g     a    -     u   c     cc g  c

References

  • Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C. Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q, Zhang R. Exp Cell Res. 2020 Mar 1;388(1):111823.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.