Mature miRNA: hsa-miR-4639-3p

Mature miRNA

miRNA Name hsa-miR-4639-3p
miRNA Sequence 5' - ucacucucaccuugcuuugc - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019698

Precursor miRNA

Precursor Name hsa-mir-4639
Genomic Location chr6:16141556-16141624 (+); nearby genomic features
NCBI GENE ID 100616269
miRBase ID MI0017266
Precursor Sequence 
u   u       c     u   uguca      ccc
 ugc aaguagg ugaga uga     gguuau   c
 ||| ||||||| ||||| |||     ||||||   
 acg uucguuc acucu acu     ccaaua   a
g   u       c     c   -----      cga

References

  • Regulation of Hsa-miR-4639-5p expression and its potential role in the pathogenesis of Parkinson's disease. He L, Chen Y, Lin S, Shen R, Pan H, Zhou Y, Wang Y, Chen S, Ding J. Aging Cell. 2023 Jun;22(6):e13840.

  • Genetic Variants of BMP2 and Their Association with the Risk of Non-Syndromic Tooth Agenesis. Lu Y, Qian Y, Zhang J, Gong M, Wang Y, Gu N, Ma L, Xu M, Ma J, Zhang W, Pan Y, Wang L. PLoS One. 2016 Jun 30;11(6):e0158273.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.