Mature miRNA: hsa-miR-455-5p

Mature miRNA

miRNA Name hsa-miR-455-5p
Previous Name hsa-miR-455
miRNA Sequence 5' - uaugugccuuuggacuacaucg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003150

Precursor miRNA

Precursor Name hsa-mir-455
Genomic Location chr9:114209434-114209529 (+); nearby genomic features
NCBI GENE ID 619556
miRBase ID MI0003513
Precursor Sequence 
----ucccu   -g     -----          u      a   c   gaa
         ggc  ugagg     guaugugccu uggacu cau gug   g
         |||  |||||     |||||||||| |||||| ||| |||   
         ccg  acucc     cauauacggg accuga gua cac   c
cuacuguau   ga     guuca          u      c   c   gac

References

  • miR-455-3p regulates lymphangiogenesis in silicosis by regulating VEGF-C/VEGFR3. He H, Wang J, Zhang Y, Wang Y, Liu Y, Li X, Zhang Y, Yang J, Hao X, Wang H, Liu H. Ecotoxicol Environ Saf. 2024 Jun 15;278:116444.

  • Unleashing Breast Cancer Progression: miR-455-5p's Targeting of SOCS3 Drives Proliferation, Migration, and Invasion. Li X, Peng B, Li J, Tian M, He L. Protein Pept Lett. 2023;30(12):992-1000.

  • MiR-455-3p mediates PPARα through UBN2 to promote apoptosis and autophagy in acute myeloid leukemia cells. Xie Y, Tan L, Wu K, Li D, Li C. Exp Hematol. 2023 Dec;128:77-88.

  • SNHG3/hsa-miR-455-5p Axis-mediated High Expression of MTHFD2 Correlates with Tumor Immune Infiltration and Endometrial Carcinoma Progression. Wu S, Cai W, Li Y, Tan W, Yuan Y, Zhou Z, Shi J, Liu X, Gao H. Int J Med Sci. 2023 Jul 3;20(8):1097-1113.

  • MiR-455-3p inhibits gastric cancer progression by repressing Wnt/β-catenin signaling through binding to ARMC8. Zhan T, Chen M, Liu W, Han Z, Zhu Q, Liu M, Tan J, Liu J, Chen X, Tian X, Huang X. BMC Med Genomics. 2023 Jul 3;16(1):155.

  • Hypoxic nasopharyngeal carcinoma-derived exosomal miR-455 increases vascular permeability by targeting ZO-1 to promote metastasis. Xie L, Zhang K, You B, Yin H, Zhang P, Shan Y, Gu Z, Zhang Q. Mol Carcinog. 2023 Jun;62(6):803-819.

  • MiR-455-5p suppresses PDZK1IP1 to promote the motility of oral squamous cell carcinoma and accelerate clinical cancer invasion by regulating partial epithelial-to-mesenchymal transition. Hsiao SY, Weng SM, Hsiao JR, Wu YY, Wu JE, Tung CH, Shen WL, Sun SF, Huang WT, Lin CY, Chen SH, Hong TM, Chen YL, Chang JY. J Exp Clin Cancer Res. 2023 Feb 3;42(1):40.

  • Circ-ATL1 silencing reverses the activation effects of SIRT5 on smooth muscle cellular proliferation, migration and contractility in intracranial aneurysm by adsorbing miR-455. Xu J, Fang C. BMC Mol Cell Biol. 2023 Jan 30;24(1):3.

  • MicroRNA-455-3p accelerate malignant progression of tumor by targeting H2AFZ in colorectal cancer. Ye L, Fan T, Qin Y, Qiu C, Li L, Dai M, Zhou Y, Chen Y, Jiang Y. Cell Cycle. 2023 Apr;22(7):777-795.

  • MicroRNA-455-3p inhibits osteosarcoma progression via HSF1 downregulation. Wang C, Zhang D, Wang L, Wang W. J Orthop Sci. 2023 Sep;28(5):1157-1164.

  • Clinical value of lncRNA SOX2-OT in pulmonary arterial hypertension and its role in pulmonary artery smooth muscle cell proliferation, migration, apoptosis, and inflammatory. Jiang Y, Hei B, Hao W, Lin S, Wang Y, Liu X, Meng X, Guan Z. Heart Lung. 2022 Sep-Oct;55:16-23.

  • Knockdown of long noncoding RNA HUMT inhibits the proliferation and metastasis by regulating miR-455-5p/LRP4 axis in hepatocellular carcinoma. Zou X, Sun P, Xie H, Fan L, Ding K, Wang J, Li Y. Bioengineered. 2022 Apr;13(4):8051-8063.

  • MicroRNA-455-3p functions as a tumor suppressor by targeting HDAC2 to regulate cell cycle in hepatocellular carcinoma. Ma F, Huang J, Li W, Li P, Liu M, Xue H. Environ Toxicol. 2022 Jul;37(7):1675-1685.

  • Effect of microRNA-455-5p (miR-455-5p) on the Expression of the Cytokine Signaling-3 (SOCS3) Gene During Myocardial Infarction. Zhang Z, Luo W, Han Y, Misrani A, Chen H, Long C. J Biomed Nanotechnol. 2022 Jan 1;18(1):202-210.

  • Mechanism of miR-455-3 in suppressing epithelial-mesenchymal transition and angiogenesis of non-small cell lung cancer cells. Meng C, Liu K, Cai X, Chen Y. Cell Stress Chaperones. 2021 Mar;27(2):107-117.

  • HOXA-AS3 Promotes Proliferation and Migration of Hepatocellular Carcinoma Cells via the miR-455-5p/PD-L1 Axis. Zeng C, Ye S, Chen Y, Zhang Q, Luo Y, Gai L, Luo B. J Immunol Res. 2021 Dec 27;2021:9289719.

  • Detection of increased serum miR-122-5p and miR-455-3p levels before the clinical diagnosis of liver cancer in people with type 2 diabetes. Lee HM, Wong WKK, Fan B, Lau ES, Hou Y, O CK, Luk AOY, Chow EYK, Ma RCW, Chan JCN, Kong APS. Sci Rep. 2021 Dec 9;11(1):23756.

  • MiR-455-5p upregulation in umbilical cord mesenchymal stem cells attenuates endometrial injury and promotes repair of damaged endometrium via Janus kinase/signal transducer and activator of transcription 3 signaling. Sun D, Jiang Z, Chen Y, Shang D, Miao P, Gao J. Bioengineered. 2021 Dec;12(2):12891-12904.

  • Microcrystalline silica particles induce inflammatory response via pyroptosis in primary human respiratory epithelial cells. Chen S, Han B, Geng X, Li P, Lavin MF, Yeo AJ, Li C, Sun J, Peng C, Shao H, Du Z. Environ Toxicol. 2022 Mar;37(3):385-400.

  • Circulating miR-455-3p, miR-5787, and miR-548a-3p as potential noninvasive biomarkers in the diagnosis of acute graft-versus-host disease: a validation study. Motaei J, Kerachian MA, Mousavi SA, Alimoghadam K, Ghavamzadeh A, Manoochehrabadi S, Ahmadvand M, Yaghmaie M. Ann Hematol. 2021 Oct;100(10):2621-2631.

    • There are 101 references associated with hsa-miR-455-5p. Click here to see the complete list in PubMed.