Mature miRNA: hsa-miR-371a-3p

Mature miRNA

miRNA Name hsa-miR-371a-3p
Previous Name hsa-miR-371;hsa-miR-371-3p
miRNA Sequence 5' - aagugccgccaucuuuugagugu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000723

Precursor miRNA

Precursor Name hsa-mir-371a
Genomic Location chr19:53787675-53787741 (+); nearby genomic features
Clustered miRNAs hsa-mir-371a,hsa-mir-371b,hsa-mir-372,hsa-mir-373 (within 10kb in genome)
NCBI GENE ID 442916
MIM ID 612043
miRBase ID MI0000779
Precursor Sequence 
            cu    g         u   c
guggcacucaaa  gugg ggcacuuuc gcu u
||||||||||||  |||| ||||||||| ||| 
cauugugaguuu  uacc ccgugaaag ugg c
            uc    g         -   u

References

  • Analysis of MicroRNA-371-373 supports that a subset of spermatocytic tumors demonstrates biologic features similar to those of GCNIS-derived germ cell tumors. Lobo J, Tavares NT, Jerónimo C, Henrique R, Dvindenko E, Cornejo KM, Berney DM, Ulbright TM, Gupta S, Acosta AM. Hum Pathol. 2024 Jun;148:66-71.

  • MiR-371-5p regulates trophoblast cell proliferation, migration, and invasion by directly targeting ZNF516. Xie ZQ, Chen F, He J, Zhong L, Luo G, Fang M. Aging (Albany NY). 2024 May 17;16(10):8585-8598.

  • Improved Analysis of Prostate Cancer: VIM3, ATG7 and P53 Form a Complex and Activate miRNA 371a-3p. Nohl EK, Behring J, Kameri E, Köditz B, Nestler T, Heidenreich A, VON Brandenstein M. Anticancer Res. 2023 Jun;43(6):2407-2416.

  • Plasma Micro-RNA 371 Expression in Early-Stage Germ Cell Tumors: Are We Ready to Move Toward Biology-Based Decision Making? Alsyouf M, Nappi L, Nichols C, Daneshmand S. J Clin Oncol. 2023 May 10;41(14):2478-2482.

  • Detection of recurrences using serum miR-371a-3p during active surveillance in men with stage I testicular germ cell tumours. Fankhauser CD, Christiansen AJ, Rothermundt C, Cathomas R, Wettstein MS, Grossmann NC, Grogg JB, Templeton AJ, Hirschi-Blickenstorfer A, Lorch A, Gillessen S, Moch H, Beyer J, Hermanns T. Br J Cancer. 2022 May;126(8):1140-1144.

  • Associations of serum levels of microRNA-371a-3p (M371) with risk factors for progression in nonseminomatous testicular germ cell tumours clinical stage 1. Dieckmann KP, Dumlupinar C, Radtke A, Matthies C, Pichler R, Paffenholz P, Sommer J, Winter A, Zengerling F, Hennig F, Wülfing C, Belge G. World J Urol. 2022 Feb;40(2):317-326.

  • Serum miR371 in testicular germ cell cancer before and after orchiectomy, assessed by digital-droplet PCR in a prospective study. Myklebust MP, Thor A, Rosenlund B, Gjengstø P, Karlsdottir Á, Brydøy M, Bercea BS, Olsen C, Johnson I, Berg MI, Langberg CW, Andreassen KE, Kjellman A, Haugnes HS, Dahl O. Sci Rep. 2021 Aug 2;11(1):15582.

  • The Diagnostic Accuracy of miR-371a-3p for Testicular Germ Cell Tumors: A Systematic Review and Meta-Analysis. Liu Q, Lian Q, Lv H, Zhang X, Zhou F. Mol Diagn Ther. 2021 May;25(3):273-281.

  • Utility of Serum miR-371a-3p in Predicting Relapse on Surveillance in Patients with Clinical Stage I Testicular Germ Cell Cancer. Lobo J, Leão R, Gillis AJM, van den Berg A, Anson-Cartwright L, Atenafu EG, Kuhathaas K, Chung P, Hansen A, Bedard PL, Jewett MAS, Warde P, O'Malley M, Sweet J, Looijenga LHJ, Hamilton RJ. Eur Urol Oncol. 2021 Jun;4(3):483-491.

  • Integrated Expression of Circulating miR375 and miR371 to Identify Teratoma and Active Germ Cell Malignancy Components in Malignant Germ Cell Tumors. Nappi L, Thi M, Adra N, Hamilton RJ, Leao R, Lavoie JM, Soleimani M, Eigl BJ, Chi K, Gleave M, So A, Black PC, Bell R, Daneshmand S, Cary C, Masterson T, Einhorn L, Nichols C, Kollmannsberger C. Eur Urol. 2021 Jan;79(1):16-19.

  • Impact of circulating microRNA test (miRNA-371a-3p) on appropriateness of treatment and cost outcomes in patients with Stage I non-seminomatous germ cell tumours. Bagrodia A, Savelyeva A, Lafin JT, Speir RW, Chesnut GT, Frazier AL, Woldu SL, Margulis V, Murray MJ, Amatruda JF, Lotan Y. BJU Int. 2021 Jul;128(1):57-64.

  • High Expression of microRNA-371a-3p in Cystic Fluid of Post-Chemotherapy Teratoma with Concurrent Normal Serum Levels in Patients with Non-Seminomatous Testicular Germ Cell Tumours. Dieckmann KP, Hennig F, Anheuser P, Gehrckens R, Viehweger F, Wülfing C, Belge G. Urol Int. 2021;105(1-2):21-26.

  • The expression of miRNA encoded by C19MC and miR-371-3 strongly varies among individual placentas but does not differ between spontaneous and induced abortions. Gottlieb A, Flor I, Nimzyk R, Burchardt L, Helmke B, Langenbuch M, Spiekermann M, Feidicker S, Bullerdiek J. Protoplasma. 2021 Jan;258(1):209-218.

  • Real-World Application of Pre-Orchiectomy miR-371a-3p Test in Testicular Germ Cell Tumor Management. Badia RR, Abe D, Wong D, Singla N, Savelyeva A, Chertack N, Woldu SL, Lotan Y, Mauck R, Ouyang D, Meng X, Lewis CM, Majmudar K, Jia L, Kapur P, Xu L, Frazier AL, Margulis V, Strand DW, Coleman N, Murray MJ, Amatruda JF, Lafin JT, Bagrodia A. J Urol. 2021 Jan;205(1):137-144.

  • miR-371a-3p, miR-373-3p and miR-367-3p as Serum Biomarkers in Metastatic Testicular Germ Cell Cancers Before, During and After Chemotherapy. Rosas Plaza X, van Agthoven T, Meijer C, van Vugt MATM, de Jong S, Gietema JA, Looijenga LHJ. Cells. 2019 Oct 8;8(10):1221.

  • Expression of miRNA-371a-3p in seminal plasma and ejaculate is associated with sperm concentration. Radtke A, Dieckmann KP, Grobelny F, Salzbrunn A, Oing C, Schulze W, Belge G. Andrology. 2019 Jul;7(4):469-474.

  • MiR-371 promotes proliferation and metastasis in hepatocellular carcinoma by targeting PTEN. Wang H, Zhao Y, Chen T, Liu G, He N, Hu H. BMB Rep. 2019 May;52(5):312-317.

  • Serum Levels of MicroRNA-371a-3p (M371 Test) as a New Biomarker of Testicular Germ Cell Tumors: Results of a Prospective Multicentric Study. Dieckmann KP, Radtke A, Geczi L, Matthies C, Anheuser P, Eckardt U, Sommer J, Zengerling F, Trenti E, Pichler R, Belz H, Zastrow S, Winter A, Melchior S, Hammel J, Kranz J, Bolten M, Krege S, Haben B, Loidl W, Ruf CG, Heinzelbecker J, Heidenreich A, Cremers JF, Oing C, Hermanns T, Fankhauser CD, Gillessen S, Reichegger H, Cathomas R, Pichler M, Hentrich M, Eredics K, Lorch A, Wülfing C, Peine S, Wosniok W, Bokemeyer C, Belge G. J Clin Oncol. 2019 Jun 1;37(16):1412-1423.

  • The Possible Involvement of miR-371a-5p Regulating XIAP in the Pathogenesis of Recurrent Pregnancy Loss. Du E, Cao Y, Feng C, Lu J, Yang H, Zhang Y. Reprod Sci. 2019 Nov;26(11):1468-1475.

  • Cellular origin of microRNA-371a-3p in healthy males based on systematic urogenital tract tissue evaluation. Boellaard WPA, Gillis AJM, van Leenders GJLH, Stoop H, van Agthoven T, Dorssers LCJ, Dinkelman-Smit M, Boormans JL, Looijenga LHJ. Andrology. 2019 Jul;7(4):463-468.

    • There are 48 references associated with hsa-miR-371a-3p. Click here to see the complete list in PubMed.