Mature miRNA: hsa-miR-3682-5p

Mature miRNA

miRNA Name hsa-miR-3682-5p
miRNA Sequence 5' - cuacuucuaccuguguuaucau - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019222

Precursor miRNA

Precursor Name hsa-mir-3682
Genomic Location chr2:53849122-53849205 (-); nearby genomic features
NCBI GENE ID 100500850
miRBase ID MI0016083
Precursor Sequence 
            g                       a   a
uaaguuauauau ucuacuucuaccuguguuaucau aua a
|||||||||||| ||||||||||||||||||||||| ||| 
auucaauauaua agauggagguggacauaguagua ugu g
            a                       c   g

References

  • MiR-3682-3p promotes esophageal cancer progression by targeting FHL1 and activating the Wnt/β-catenin signaling pathway. Cai Y, Xia L, Zhu H, Cheng H, Tian Y, Sun L, Wang J, Lu N, Wang J, Chen Y. Cell Signal. 2024 Jul;119:111155.

  • Celestial Insights: Unraveling the Role of miR-3682-3p in Hepatocellular Carcinoma. Miao PD, Li Y, Jiang YD. Clin Transl Gastroenterol. 2024 Apr 1;15(4):e00690.

  • miR-3682-3p Activated by c-Myc Aggravates the Migration and Stemness in Hepatocellular Carcinoma Cells by Regulating PTEN/PI3K/AKT/β-Catenin Signaling. Zhang Y, Cai H, Wu MH, Zhu DH, Wang XY, Chen ZY, Yang L, Liu P, Liu Z. Dig Dis. 2023;41(3):447-457.

  • [High expression of miR-3682-3p is an unfavorable prognostic factor of hepatocellular carcinoma]. Liu S, Wen Y, Quan B, Lin J, Zhu Z, Tang J, Han S. Nan Fang Yi Ke Da Xue Xue Bao. 2021 Dec 20;41(12):1885-1891.

  • MiR-3682 promotes the progression of hepatocellular carcinoma (HCC) via inactivating AMPK signaling by targeting ADRA1A. Zhao W, Liu X. Ann Hepatol. 2022 Jan;27 Suppl 1:100570.

  • BMI1 activates P-glycoprotein via transcription repression of Chen MK, Zhou JH, Wang P, Ye YL, Liu Y, Zhou JW, Chen ZJ, Yang JK, Liao DY, Liang ZJ, Xie X, Zhou QZ, Xue KY, Guo WB, Xia M, Bao JM, Yang C, Duan HF, Wang HY, Huang ZP, Qin ZK, Liu CD. Aging (Albany NY). 2021 Jul 16;13(14):18310-18330.

  • A novel prognostic mRNA/miRNA signature for esophageal cancer and its immune landscape in cancer progression. Zhao Y, Xu L, Wang X, Niu S, Chen H, Li C. Mol Oncol. 2021 Apr;15(4):1088-1109.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A. BMC Genomics. 2010 May 7;11:288.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.