Mature miRNA: hsa-miR-340-5p

Mature miRNA

miRNA Name hsa-miR-340-5p
Previous Name hsa-miR-340
miRNA Sequence 5' - uuauaaagcaaugagacugauu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004692

Precursor miRNA

Precursor Name hsa-mir-340
Genomic Location chr5:180015303-180015397 (-); nearby genomic features
NCBI GENE ID 442908
miRBase ID MI0000802
Precursor Sequence 
--uu     u      au       -caa      u    g     ug
    guacc ggugug  uauaaag    ugagac gauu ucaua  u
    ||||| ||||||  |||||||    |||||| |||| |||||   c
    uaugg ccauac  auauuuc    acucug cuag ggugu  g
auuc     u      cg       auug      c    -     uu

References

  • GTF2E2 downregulated by miR-340-5p inhibits the malignant progression of glioblastoma. Qiao X, Chen Y, Wang Z, Peng N, Niu W, Hou S, Wu J, Ji Y, Niu C, Cheng C. Cancer Gene Ther. 2023 Dec;30(12):1702-1714.

  • LncRNA CASC19 Enhances the Radioresistance of Nasopharyngeal Carcinoma by Regulating the miR-340-3p/FKBP5 Axis. Liu H, Chen Q, Zheng W, Zhou Y, Bai Y, Pan Y, Zhang J, Shao C. Int J Mol Sci. 2023 Feb 3;24(3):3047.

  • FGF23 promotes proliferation, migration and invasion by regulating miR-340-5p in osteosarcoma. Fang L, Li Z, Yu B, Zhou L. J Orthop Surg Res. 2023 Jan 5;18(1):12.

  • Overexpression of CENPL mRNA potentially regulated by miR-340-3p predicts the prognosis of pancreatic cancer patients. Cui Z, Du L, Wang J, Li Z, Xu J, Ou S, Li D, Li S, Hu H, Chen G, Wu Z. BMC Cancer. 2022 Dec 26;22(1):1354.

  • Hsa_circ_0019054 up-regulates HIF1A through sequestering miR-340-5p to promote the tumorigenesis of intrahepatic cholangiocarcinoma. Tang J, Tang R, Gu P, Han J, Huang W, Xue F. Hum Exp Toxicol. 2022 Jan-Dec;41:9603271221126494.

  • Hsa_circ_0016070/micro-340-5p Axis Accelerates Pulmonary Arterial Hypertension Progression by Upregulating TWIST1 Transcription Via TCF4/β-Catenin Complex. Huang CX, Jiang ZX, Du DY, Zhang ZM, Liu Y, Li YT. J Am Heart Assoc. 2022 Jul 19;11(14):e024147.

  • lncRNA XIST is associated with preeclampsia and mediates trophoblast cell invasion via miR-340-5p/KCNJ16 signaling pathway. Guo Y, Gao Y, Liu S. Transpl Immunol. 2022 Oct;74:101666.

  • Mechanism of miR-340-5p in laryngeal cancer cell proliferation and invasion through the lncRNA NEAT1/MMP11 axis. Gao C, Zhang Y, Sun H. Pathol Res Pract. 2022 Aug;236:153912.

  • miR-340-5p affects oral squamous cell carcinoma (OSCC) cells proliferation and invasion by targeting endoplasmic reticulum stress proteins. Ou D, Wu Y, Zhang J, Liu J, Liu Z, Shao M, Guo X, Cui S. Eur J Pharmacol. 2022 Apr 5;920:174820.

  • Overexpression of miR-340 inhibits cell proliferation and induces apoptosis of human bladder cancer via targeting Glut-1. Xu G, Pan S, Zhu Z, Li J. BMC Urol. 2021 Dec 3;21(1):168.

  • MiR-340-5p inhibits Müller cell activation and pro-inflammatory cytokine production by targeting BMP4 in experimental diabetic retinopathy. Wu L, Li J, Zhao F, Xiang Y. Cytokine. 2022 Jan;149:155745.

  • Long intergenic non-protein coding RNA 1094 (LINC01094) promotes the progression of breast cancer (BC) by regulating the microRNA-340-5p (miR-340-5p)/E2F transcription factor 3 (E2F3) axis. Wu X, Kong C, Wu Y. Bioengineered. 2021 Dec;12(1):9046-9057.

  • The Role of miRNAs 340-5p, 92a-3p, and 381-3p in Patients with Endometriosis: A Plasma and Mesenchymal Stem-Like Cell Study. Bahramy A, Zafari N, Izadi P, Soleymani F, Kavousi S, Noruzinia M. Biomed Res Int. 2021 Sep 29;2021:5298006.

  • A novel circular RNA circPPFIA1 promotes laryngeal squamous cell carcinoma progression through sponging miR-340-3p and regulating ELK1 expression. Shuang Y, Liu J, Niu J, Guo W, Li C. Bioengineered. 2021 Dec;12(1):5220-5230.

  • CircN4BP2L2 promotes colorectal cancer growth and metastasis through regulation of the miR-340-5p/CXCR4 axis. Yang KD, Wang Y, Zhang F, Luo BH, Feng DY, Zeng ZJ. Lab Invest. 2022 Jan;102(1):38-47.

  • Reduction of lamin B receptor levels by miR-340-5p disrupts chromatin, promotes cell senescence and enhances senolysis. Herman AB, Anerillas C, Harris SC, Munk R, Martindale JL, Yang X, Mazan-Mamczarz K, Zhang Y, Heckenbach IJ, Scheibye-Knudsen M, De S, Sen P, Abdelmohsen K, Gorospe M. Nucleic Acids Res. 2021 Jul 21;49(13):7389-7405.

  • Circular RNA circ-CHI3L1.2 modulates cisplatin resistance of osteosarcoma cells via the miR-340-5p/LPAATβ axis. Zhang Z, Zhou Q, Luo F, Zhou R, Xu J, Xiao J, Dai F, Song L. Hum Cell. 2021 Sep;34(5):1558-1568.

  • MicroRNA-340-5p inhibits the malignant phenotypes of osteosarcoma by directly targeting NRF2 and deactivating the PI3K/AKT pathway. Fan HP, Wang SY, Shi YY, Sun J. Eur Rev Med Pharmacol Sci. 2021 May;25(10):3661-3669.

  • LncRNA RUSC1-AS1 promotes osteosarcoma progression through regulating the miR-340-5p and PI3K/AKT pathway. Tong CJ, Deng QC, Ou DJ, Long X, Liu H, Huang K. Aging (Albany NY). 2021 May 28;13(16):20116-20130.

  • MiR-340 Promotes the Proliferation of Vascular Smooth Muscle Cells by Targeting von Hippel-Lindau Tumor Suppressor Gene. Chen S, Zhao W, Min H, Xu Y. J Cardiovasc Pharmacol. 2021 Jun 1;77(6):875-884.

    • There are 119 references associated with hsa-miR-340-5p. Click here to see the complete list in PubMed.