Mature miRNA: hsa-miR-338-3p



Mature miRNA

miRNA Name hsa-miR-338-3p
Previous Name hsa-miR-338
miRNA Sequence 5' - uccagcaucagugauuuuguug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000763

Precursor miRNA

Precursor Name hsa-mir-338
Genomic Location chr17:81125883-81125949 (-); nearby genomic features
Clustered miRNAs hsa-mir-657,hsa-mir-3065,hsa-mir-338,hsa-mir-1250 (within 10kb in genome)
NCBI GENE ID 442906
MIM ID 614059
miRBase ID MI0000814
Precursor Sequence
   c      u   -         -   gauga
ucu caacaa auc cuggugcug agu     c
||| |||||| ||| ||||||||| |||      u
aga guuguu uag gacuacgac uca     c
   a      u   u         c   gcgga

References


  • ALKBH5-mediated m6A modification of circFOXP1 promotes gastric cancer progression by regulating SOX4 expression and sponging miR-338-3p. Wang S, Zhu X, Hao Y, Su TT, Shi W. Commun Biol. 2024 May 14;7(1):565.

  • CircRNA HLCS regulates lens epithelial cell apoptosis via miR-338-3p/BPNT1 axis. Sun L, Li F, Bai S, Bi C. Int Ophthalmol. 2024 Mar 17;44(1):142.

  • CircFBXW4 Suppresses Colorectal Cancer Progression by Regulating the MiR-338-5p/SLC5A7 Axis. Song W, Fu J, Wu J, Ren J, Xiang R, Kong C, Fu T. Adv Sci (Weinh). 2024 May;11(18):e2300129.

  • Bone marrow mesenchymal stem cell-derived exosomes promote osteoblast proliferation, migration and inhibit apoptosis by regulating KLF3-AS1/miR-338-3p. Liu D, Zhao X, Zhang Q, Zhou F, Tong X. BMC Musculoskelet Disord. 2024 Feb 9;25(1):122.

  • Mir-338-3p targeting THBS1 attenuates glioma progression by inhibiting the PI3K/Akt pathway. Jiang L, Fang T, Hu T, Feng J, Yan P. Biol Direct. 2024 Jan 24;19(1):9.

  • CircularRNA Hsa_circ_0093335 promotes hepatocellular carcinoma progression via sponging miR-338-5p. Qin X, Zhou L, Shen Y, Gu Y, Tang J, Qian J, Cui A, Chen M. J Cell Mol Med. 2023 Dec;27(24):4080-4092.

  • Mechanism of lncRNA FOXD3-AS1/miR-338-3p in the malignant progression of nasopharyngeal carcinoma through ceRNA. Li Y, Zhao S, Chen B. Cell Mol Biol (Noisy-le-grand). 2023 Jun 30;69(6):82-87.

  • LncRNA MALAT1 regulates growth of carcinoma of the lung through modulating miR-338-3p/PYCR2 axis. Geng Y, Chen P, Zhang L, Li X, Song C, Wei X, Gong H. Cell Mol Biol (Noisy-le-grand). 2023 Apr 30;69(4):133-140.

  • Circ_0003747 promotes thyroid cancer progression by sponging miR-338-3p to upregulate PLCD3 expression. Dou XL, Xia FD, Li XY. Epigenetics. 2023 Dec;18(1):2210339.

  • Circ_RBM23 knockdown suppresses chemoresistance, proliferation, migration and invasion of sorafenib-resistant HCC cells through miR-338-3p/RAB1B axis. Xu C, Sun W, Liu J, Pu H, Li Y. Pathol Res Pract. 2023 May;245:154435.

  • The estrogen/miR-338-3p/ADAM17 axis enhances the viability of breast cancer cells via suppressing NK cell's function. Shi Y, Pan J, Hang C, Tan L, Hu L, Yan Z, Zhu J. Environ Toxicol. 2023 Jul;38(7):1618-1627.

  • Exosomal Circ_FMN2 Derived from the Serum of Colorectal Cancer Patients Promotes Cancer Progression by miR-338-3p/MSI1 Axis. Yu Q, Zhang Y, Tian Y, Peng A, Cui X, Ding B, Yang L, Liu Y, Ju Y, Gao C. Appl Biochem Biotechnol. 2023 Dec;195(12):7322-7337.

  • Circ_0124208 Promotes the Progression of Hepatocellular Carcinoma by Regulating the miR-338-3p/LAMC1 Axis. Chen J, Liu Z, Zhong Y, Chen H, Xie L. Mol Biotechnol. 2023 Nov;65(11):1750-1763.

  • microRNA-338-3p suppresses lipopolysaccharide-induced inflammatory response in HK-2 cells. Wang J, Li G, Lin M, Lin S, Wu L. BMC Mol Cell Biol. 2022 Dec 23;23(1):60.

  • Silencing of lncRNA KLF3-AS1 represses cell growth in osteosarcoma via miR-338-3p/MEF2C axis. Chen C, Liu L. J Clin Lab Anal. 2022 Nov;36(11):e24698.

  • miRNA-338-3p inhibits the migration, invasion and proliferation of human lung adenocarcinoma cells by targeting MAP3K2. Zhang B, Wang D, Wang Y, Chen G. Aging (Albany NY). 2022 Aug 3;14(15):6094-6110.

  • Mechanism of miR-338-3p in sepsis-induced acute lung injury via indirectly modulating ATF4. Yang J, Huang Q, Liao P, Zhang P, Sun S, Xu Q. Transpl Immunol. 2023 Feb;76:101681.

  • miR-338-3p Plays a Significant Role in Casticin-Induced Suppression of Acute Myeloid Leukemia via Targeting PI3K/Akt Pathway. Yu K, Wang J, Hou J, Zhang L, Liang H. Biomed Res Int. 2022 Jun 18;2022:9214130.

  • Knockdown of circ_0026579 ameliorates lipopolysaccharide (bacterial origin)-induced inflammatory injury in bronchial epithelium cells by targeting miR-338-3p/TBL1XR1 axis. Cheng S, Chen C, Wang L. Transpl Immunol. 2022 Oct;74:101635.

  • Circ_0000274 contributes to renal cell carcinoma progression by regulating miR-338-3p/NUCB2 axis and JAK1/STAT3 pathway. Qi Q, Sun Y, Yang Y, Liu Y. Transpl Immunol. 2022 Oct;74:101626.


  • There are 160 references associated with hsa-miR-338-3p. Click here to see the complete list in PubMed.