Mature miRNA: hsa-miR-3189-3p

Mature miRNA

miRNA Name hsa-miR-3189-3p
Previous Name hsa-miR-3189
miRNA Sequence 5' - cccuugggucugaugggguag - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015071

Precursor miRNA

Precursor Name hsa-mir-3189
Genomic Location chr19:18386562-18386634 (+); nearby genomic features
NCBI GENE ID 100422943
miRBase ID MI0014233
Precursor Sequence 
  c  a           ugu    -u   ----    a
gc uc guugccccauc   gccc  ggg    uagg a
|| || |||||||||||   ||||  |||    ||||  u
cg ag cgaugggguag   uggg  ccc    gucc a
  u  c           -uc    uu   cuag    u

References

  • A novel interplay between PRC2 and miR-3189 regulates epithelial-mesenchymal transition (EMT) via modulating COL6A2 in glioblastoma. Sharma V, Vinchure OS, Yadav G, Sarkar C, Kulshreshtha R. J Cell Physiol. 2024 Aug;239(8):e31326.

  • miR-3189-targeted GLUT3 repression by HDAC2 knockdown inhibits glioblastoma tumorigenesis through regulating glucose metabolism and proliferation. Kwak S, Park SH, Kim SH, Sung GJ, Song JH, Jeong JH, Kim H, Ha CH, Kim SW, Choi KC. J Exp Clin Cancer Res. 2022 Mar 8;41(1):87.

  • miR-3189-3p Mimics Enhance the Effects of S100A4 siRNA on the Inhibition of Proliferation and Migration of Gastric Cancer Cells by Targeting CFL2. Bian Y, Guo J, Qiao L, Sun X. Int J Mol Sci. 2018 Jan 13;19(1):236.

  • Growth differentiation factor-15 encodes a novel microRNA 3189 that functions as a potent regulator of cell death. Jones MF, Li XL, Subramanian M, Shabalina SA, Hara T, Zhu Y, Huang J, Yang Y, Wakefield LM, Prasanth KV, Lal A. Cell Death Differ. 2015 Oct;22(10):1641-53.

  • Anti-tumoral effects of miR-3189-3p in glioblastoma. Jeansonne D, DeLuca M, Marrero L, Lassak A, Pacifici M, Wyczechowska D, Wilk A, Reiss K, Peruzzi F. J Biol Chem. 2015 Mar 27;290(13):8067-80.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.