Mature miRNA: hsa-miR-3150b-3p

Mature miRNA

miRNA Name hsa-miR-3150b-3p
Previous Name hsa-miR-3150b
miRNA Sequence 5' - ugaggagaucgucgagguugg - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0018194
Similar miRNAs hsa-miR-4784 (sharing the same seed sequence with hsa-miR-3150b-3p).

Precursor miRNA

Precursor Name hsa-mir-3150b
Genomic Location chr8:95072911-95072996 (-); nearby genomic features
Clustered miRNAs hsa-mir-3150b,hsa-mir-3150a (within 10kb in genome)
NCBI GENE ID 100500907
miRBase ID MI0016426
Precursor Sequence 
     a                 g       c    -    g
gaggg aagcaggccaaccucga gaucucc cagc cuug c
||||| ||||||||||||||||| ||||||| |||| ||||  g
cuccc uucguccgguuggagcu cuagagg gucg ggac u
     c                 g       a    u    u

References

  • LncRNA RP11-116G8.5 promotes the progression of lung squamous cell carcinoma through sponging miR-3150b-3p/miR-6870-5p to upregulate PHF12/FOXP4. Li H, Zhao Q, Tang Z. Pathol Res Pract. 2021 Oct;226:153566.

  • Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia. Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML. Leukemia. 2011 Sep;25(9):1389-99.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Discovery of novel microRNAs in female reproductive tract using next generation sequencing. Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH. PLoS One. 2010 Mar 10;5(3):e9637.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.