Mature miRNA: hsa-miR-3129-3p

Mature miRNA

miRNA Name hsa-miR-3129-3p
miRNA Sequence 5' - aaacuaaucucuacacugcugc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019202
Similar miRNAs hsa-miR-5583-5p (sharing the same seed sequence with hsa-miR-3129-3p).

Precursor miRNA

Precursor Name hsa-mir-3129
Genomic Location chr2:189133036-189133111 (-); nearby genomic features
NCBI GENE ID 100422908
miRBase ID MI0014146
Precursor Sequence 
gua                            ccu   a
   cuugggcaguaguguagagauugguuug   guu a
   ||||||||||||||||||||||||||||   ||| 
   gaacccgucgucacaucucuaaucaaac   uaa u
cga                            --u   g

References

  • Tumor cells derived-extracellular vesicles transfer miR-3129 to promote hepatocellular carcinoma metastasis by targeting TXNIP. Yang Y, Mao F, Guo L, Shi J, Wu M, Cheng S, Guo W. Dig Liver Dis. 2021 Apr;53(4):474-485.

  • Elevated serum miR-3129-5p contributes to the progression of coronary heart disease via targeting mTOR. Wang ZY, Zhao T, Zhou J, Gao F. Kaohsiung J Med Sci. 2021 Apr;37(4):314-323.

  • LncRNA MALAT1 mediates doxorubicin resistance of hepatocellular carcinoma by regulating miR-3129-5p/Nova1 axis. Cao Y, Zhang F, Wang H, Bi C, Cui J, Liu F, Pan H. Mol Cell Biochem. 2021 Jan;476(1):279-292.

  • Upregulation of microRNA-3129 suppresses epithelial ovarian cancer through CD44. Sun X, Cui M, Tong L, Zhang A, Wang K. Cancer Gene Ther. 2018 Dec;25(11-12):317-325.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • Discovery of novel microRNAs in female reproductive tract using next generation sequencing. Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH. PLoS One. 2010 Mar 10;5(3):e9637.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.