Mature miRNA: hsa-miR-3124-3p

Mature miRNA

miRNA Name hsa-miR-3124-3p
miRNA Sequence 5' - acuuuccucacucccgugaagu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019200

Precursor miRNA

Precursor Name hsa-mir-3124
Genomic Location chr1:248826377-248826443 (+); nearby genomic features
NCBI GENE ID 100422879
miRBase ID MI0014140
Precursor Sequence 
  g           c -a   c      g    c
gc ggcuucgcggg g  agg aaaguc auuu c
|| ||||||||||| |  ||| |||||| |||| 
cg cugaagugccc c  ucc uuucag ugaa a
  g           u ac   -      -    a

References

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • Discovery of novel microRNAs in female reproductive tract using next generation sequencing. Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH. PLoS One. 2010 Mar 10;5(3):e9637.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.