Mature miRNA: hsa-miR-302b-5p

Mature miRNA

miRNA Name hsa-miR-302b-5p
Previous Name hsa-miR-302b*
miRNA Sequence 5' - acuuuaacauggaagugcuuuc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000714
Similar miRNAs hsa-miR-302d-5p (sharing the same seed sequence with hsa-miR-302b-5p).

Precursor miRNA

Precursor Name hsa-mir-302b
Genomic Location chr4:112648485-112648557 (-); nearby genomic features
Clustered miRNAs hsa-mir-367,hsa-mir-302d,hsa-mir-302a,hsa-mir-302c,hsa-mir-302b (within 10kb in genome)
NCBI GENE ID 442894
MIM ID 614597
miRBase ID MI0000772
Precursor Sequence 
     cuuca   uu          ug   u  guga
gcucc     acu  aacauggaag  cuu cu    c
|||||     |||  ||||||||||  ||| ||     u
ugagg     uga  uuguaccuuc  gaa ga    u
     ----a   uu          gu   u  aaau

References

  • Hypoxia enhances anti-fibrotic properties of extracellular vesicles derived from hiPSCs via the miR302b-3p/TGFβ/SMAD2 axis. Paw M, Kusiak AA, Nit K, Litewka JJ, Piejko M, Wnuk D, Sarna M, Fic K, Stopa KB, Hammad R, Barczyk-Woznicka O, Cathomen T, Zuba-Surma E, Madeja Z, Ferdek PE, Bobis-Wozowicz S. BMC Med. 2023 Oct 31;21(1):412.

  • LncRNA XIST facilitates hypertrophy of ligamentum flavum by activating VEGFA-mediated autophagy through sponging miR-302b-3p. Cao Y, Li J, Qiu S, Ni S, Duan Y. Biol Direct. 2023 May 24;18(1):25.

  • Analysis of the subcellular location of FAM230B and its interaction with premature miR-302b in osteosarcoma. Cheng S, Wang W. J Bone Miner Metab. 2022 Jul;40(4):554-560.

  • Low expression of lncRNA SBF2-AS1 regulates the miR-302b-3p/TGFBR2 axis, promoting metastasis in laryngeal cancer. Li Y, Tang B, Lyu K, Yue H, Wei F, Xu Y, Chen S, Lin Y, Cai Z, Guo X, Li C, Lei W. Mol Carcinog. 2022 Jan;61(1):45-58.

  • SOX-17 is involved in invasion and apoptosis of colorectal cancer cells through regulating miR-302b-3p expression. Hu F, Li M, Mo L, Xiao Y, Wang X, Xie B. Cell Biol Int. 2021 Jun;45(6):1296-1305.

  • MiR-302b Suppresses Tumor Metastasis by Targeting Sun S, Wang J, Liu J, Yin F, Xin C, Zeng X, Li J, Chen Q. J Dent Res. 2021 Jul;100(7):739-745.

  • Silencing of miR-302b-3p alleviates isoflurane-induced neuronal injury by regulating PTEN expression and AKT pathway. Li L, Lu S, Fan X. Brain Res Bull. 2021 Mar;168:89-99.

  • Circular RNA circ_HN1 facilitates gastric cancer progression through modulation of the miR-302b-3p/ROCK2 axis. Wang D, Jiang X, Liu Y, Cao G, Zhang X, Kuang Y. Mol Cell Biochem. 2021 Jan;476(1):199-212.

  • LncUBE2R2-AS1 acts as a microRNA sponge of miR-302b to promote HCC progression via activation EGFR-PI3K-AKT signaling pathway. Wu Z, Wei ZH, Chen SH. Cell Cycle. 2020 Oct;19(19):2426-2435.

  • Extracellular Vesicles from Healthy Cells Improves Cell Function and Stemness in Premature Senescent Stem Cells by miR-302b and HIF-1α Activation. Mas-Bargues C, Sanz-Ros J, Román-Domínguez A, Gimeno-Mallench L, Inglés M, Viña J, Borrás C. Biomolecules. 2020 Jun 25;10(6):957.

  • MiR-302b-5p enhances the neuroprotective effect of IGF-1 in methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced Parkinson's disease by regulating inducible nitric-oxide synthase. Cui X, Li M, He Z, Hu L, Liu J, Yan J, Hua L. Cell Biochem Funct. 2020 Dec;38(8):1025-1035.

  • The microRNAs miR-302b and miR-372 regulate mitochondrial metabolism via the SLC25A12 transporter, which controls MAVS-mediated antiviral innate immunity. Yasukawa K, Kinoshita D, Yaku K, Nakagawa T, Koshiba T. J Biol Chem. 2020 Jan 10;295(2):444-457.

  • miRNA-302s may act as oncogenes in human testicular germ cell tumours. Das MK, Evensen HSF, Furu K, Haugen TB. Sci Rep. 2019 Jun 24;9(1):9189.

  • Evaluation of miR-302b-5p expression and molecular mechanism in hepatocellular carcinoma: Findings based on RT-qPCR and in silico analysis. Wu HY, Cai KT, Ma J, Chen G, Dang YW, Lu HP, Pan SL. Pathol Res Pract. 2019 Jul;215(7):152424.

  • Downregulation of N-Acetylglucosaminyltransferase GCNT3 by miR-302b-3p Decreases Non-Small Cell Lung Cancer (NSCLC) Cell Proliferation, Migration and Invasion. Li Q, Ran P, Zhang X, Guo X, Yuan Y, Dong T, Zhu B, Zheng S, Xiao C. Cell Physiol Biochem. 2018;50(3):987-1004.

  • The DEAD-box RNA-binding protein DDX6 regulates parental RNA decay for cellular reprogramming to pluripotency. Kami D, Kitani T, Nakamura A, Wakui N, Mizutani R, Ohue M, Kametani F, Akimitsu N, Gojo S. PLoS One. 2018 Oct 1;13(10):e0203708.

  • MicroRNA Expression Analysis of In Vitro Dedifferentiated Human Pancreatic Islet Cells Reveals the Activation of the Pluripotency-Related MicroRNA Cluster miR-302s. Sebastiani G, Grieco GE, Brusco N, Ventriglia G, Formichi C, Marselli L, Marchetti P, Dotta F. Int J Mol Sci. 2018 Apr 12;19(4):1170.

  • MicroRNA-302b negatively regulates IL-1β production in response to MSU crystals by targeting IRAK4 and EphA2. Ma T, Liu X, Cen Z, Xin C, Guo M, Zou C, Song W, Xie R, Wang K, Zhou H, Zhang J, Wang Z, Bian C, Cui K, Li J, Wei YQ, Li J, Zhou X. Arthritis Res Ther. 2018 Feb 26;20(1):34.

  • miR-302b inhibits tumorigenesis by targeting EphA2 via Wnt/ β-catenin/EMT signaling cascade in gastric cancer. Huang J, He Y, Mcleod HL, Xie Y, Xiao D, Hu H, Chen P, Shen L, Zeng S, Yin X, Ge J, Li L, Tang L, Ma J, Chen Z. BMC Cancer. 2017 Dec 22;17(1):886.

  • MiR-302b Suppresses Osteosarcoma Cell Migration and Invasion by Targeting Runx2. Xie Y, Sun W, Deng Z, Zhu X, Hu C, Cai L. Sci Rep. 2017 Oct 17;7(1):13388.

    • There are 38 references associated with hsa-miR-302b-5p. Click here to see the complete list in PubMed.