Mature miRNA: hsa-miR-301b-5p

Mature miRNA

miRNA Name hsa-miR-301b-5p
miRNA Sequence 5' - gcucugacgagguugcacuacu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0032026
Similar miRNAs hsa-miR-301a-5p (sharing the same seed sequence with hsa-miR-301b-5p).

Precursor miRNA

Precursor Name hsa-mir-301b
Genomic Location chr22:21652981-21653058 (+); nearby genomic features
Clustered miRNAs hsa-mir-301b,hsa-mir-130b (within 10kb in genome)
NCBI GENE ID 100126318
miRBase ID MI0005568
Precursor Sequence 
---g  g        c      ---g        a  gug u
    cc caggugcu ugacga    guugcacu cu   c c
    || |||||||| ||||||    |||||||| ||   |  u
    gg gucuacga acuguu    uaacguga ga   g g
acca  -        a      auag        c  --a a

References

  • Expression profile and functional analysis of miR-301b in patients with breast cancer: A bioinformatics, biochemical, and histopathological study. Taha M, Yousef E, Badr AN, Salama RA, Maurice N. Pathol Res Pract. 2024 Oct;262:155536.

  • Overexpression Pattern of miR-301b in Osteosarcoma and Its Relevance with Osteosarcoma Cellular Behaviors via Modulating SNX10. Wang Y, Sun N, Zhang Z, Zhou Y, Liu H, Zhou X, Zhang Y, Zhao Y. Biochem Genet. 2023 Feb;61(1):87-100.

  • CircARHGAP12 Triggers Mesenchymal Stromal Cell Autophagy to Facilitate its Effect on Repairing Diabetic Wounds by Sponging miR-301b-3p/ATG16L1 and miR-301b-3p/ULK2. Meng F, Shen F, Ling H, Jin P, Zhou D, Li Q. J Invest Dermatol. 2022 Jul;142(7):1976-1989.e4.

  • LINC01089, suppressed by YY1, inhibits lung cancer progression by targeting miR-301b-3p/HPDG axis. Yang R, Liu Z, Cao H, Shi Y. Cell Biol Toxicol. 2022 Dec;38(6):1063-1077.

  • MicroRNA-301b-3p facilitates cell proliferation and migration in colorectal cancer by targeting HOXB1. Xiong J, Zhang L, Tang R, Zhu Z. Bioengineered. 2021 Dec;12(1):5839-5849.

  • MiR-301b-3p Promotes the Occurrence and Development of Breast Cancer Cells via Targeting HOXA5. Lu X, Duan J, Zhou R, Xu Y. Crit Rev Eukaryot Gene Expr. 2021;31(3):35-44.

  • LINC01089 suppresses lung adenocarcinoma cell proliferation and migration via miR-301b-3p/STARD13 axis. Qian Y, Zhang Y, Ji H, Shen Y, Zheng L, Cheng S, Lu X. BMC Pulm Med. 2021 Jul 19;21(1):242.

  • MIR-301b-3p Promotes Lung Adenocarcinoma Cell Proliferation, Migration and Invasion by Targeting DLC1. Liu H, Ma X, Niu N, Zhao J, Lu C, Yang F, Qi W. Technol Cancer Res Treat. 2021 Jan-Dec;20:1533033821990036.

  • Smoking load reduction is insufficient to downregulate miR-301b, a lung cancer promoter. Dos Santos Arcas C, Lin-Wang HT, Umeda IIK, de Sousa MG, Utiyama DMO, de Padua Mansur A, Macchione M, Hirata MH, Nakagawa NK. Sci Rep. 2020 Dec 3;10(1):21112.

  • miR-301b and NR3C2 co-regulate cells malignant properties and have the potential to be independent prognostic factors in breast cancer. Peng Y, Xi X, Li J, Ni J, Yang H, Wen C, Wen M. J Biochem Mol Toxicol. 2021 Feb;35(2):e22650.

  • SLC16A1-AS1 enhances radiosensitivity and represses cell proliferation and invasion by regulating the miR-301b-3p/CHD5 axis in hepatocellular carcinoma. Pei S, Chen Z, Tan H, Fan L, Zhang B, Zhao C. Environ Sci Pollut Res Int. 2020 Dec;27(34):42778-42790.

  • Oncogenic microRNA-301b regulates tumor repressor dystrobrevin alpha to facilitate cell growth, invasion and migration in esophageal cancer. Fu G, Pei Z, Song N. Esophagus. 2021 Apr;18(2):315-325.

  • Inhibiting microRNA-301b suppresses cell growth and targets RNF38 in cervical carcinoma. Guo WL, Li N, Ma JL, Chen XM, Shi FY. Kaohsiung J Med Sci. 2020 Nov;36(11):878-884.

  • MicroRNA-301b-3p accelerates the growth of gastric cancer cells by targeting zinc finger and BTB domain containing 4. Fan H, Jin X, Liao C, Qiao L, Zhao W. Pathol Res Pract. 2019 Nov;215(11):152667.

  • Hypoxia induced microRNA-301b-3p overexpression promotes proliferation, migration and invasion of prostate cancer cells by targeting LRP1B. Zheng H, Bai L. Exp Mol Pathol. 2019 Dec;111:104301.

  • MicroRNA-301b-3p contributes to tumour growth of human hepatocellular carcinoma by repressing vestigial like family member 4. Guo Y, Yao B, Zhu Q, Xiao Z, Hu L, Liu X, Li L, Wang J, Xu Q, Yang L, Huang D. J Cell Mol Med. 2019 Aug;23(8):5037-5047.

  • MicroRNA-301b promotes the proliferation and invasion of glioma cells through enhancing activation of Wnt/β-catenin signaling via targeting Glypican-5. Hong X, Zhang Z, Pan L, Ma W, Zhai X, Gu C, Zhang Y, Bi X, Huang W, Pei H, Liu Z. Eur J Pharmacol. 2019 Jul 5;854:39-47.

  • miRNA-301b-3p accelerates migration and invasion of high-grade ovarian serous tumor via targeting CPEB3/EGFR axis. Liu F, Zhang G, Lv S, Wen X, Liu P. J Cell Biochem. 2019 Aug;120(8):12618-12627.

  • MicroRNA-301b promotes cell proliferation and apoptosis resistance in triple-negative breast cancer by targeting CYLD. Song H, Li D, Wu T, Xie D, Hua K, Hu J, Deng X, Ji C, Deng Y, Fang L. BMB Rep. 2018 Nov;51(11):602-607.

  • Association study of miR-100, miR-124-1, miR-218-2, miR-301b, miR-605, and miR-4293 polymorphisms and the risk of breast cancer in a sample of Iranian population. Danesh H, Hashemi M, Bizhani F, Hashemi SM, Bahari G. Gene. 2018 Mar 20;647:73-78.

    • There are 34 references associated with hsa-miR-301b-5p. Click here to see the complete list in PubMed.