Mature miRNA: hsa-miR-1912-5p

Mature miRNA

miRNA Name hsa-miR-1912-5p
miRNA Sequence 5' - cucauugcaugggcuguguaua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0037333

Precursor miRNA

Precursor Name hsa-mir-1912
Genomic Location chrX:114651544-114651623 (+); nearby genomic features
Clustered miRNAs hsa-mir-1912,hsa-mir-1264 (within 10kb in genome)
NCBI GENE ID 100302144
miRBase ID MI0008333
Precursor Sequence 
---     gg    g u         gg   u    a ua
   cucua  augu c cauugcaug  cug guau g  u
   |||||  |||| | |||||||||  ||| |||| |   u
   gagau  uaca g gugacguac  gac caua c  a
uua     aa    a u         ga   c    a uu

References

  • Investigation on tissue specific effects of pro-apoptotic micro RNAs revealed miR-147b as a potential biomarker in ovarian cancer prognosis. Kleemann M, Bereuther J, Fischer S, Marquart K, Hänle S, Unger K, Jendrossek V, Riedel CU, Handrick R, Otte K. Oncotarget. 2017 Mar 21;8(12):18773-18791.

  • Selective microRNA-Offset RNA expression in human embryonic stem cells. Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O. PLoS One. 2015 Mar 30;10(3):e0116668.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors. Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP. PLoS One. 2009 Sep 28;4(9):e7192.

  • MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries. Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M. Stem Cells. 2008 Oct;26(10):2496-505.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.