Mature miRNA: hsa-miR-15a-5p

Mature miRNA

miRNA Name hsa-miR-15a-5p
Previous Name hsa-miR-15a
miRNA Sequence 5' - uagcagcacauaaugguuugug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000068
Similar miRNAs hsa-miR-15b-5p, hsa-miR-16-5p, hsa-miR-195-5p, hsa-miR-424-5p, hsa-miR-497-5p, hsa-miR-6838-5p (sharing the same seed sequence with hsa-miR-15a-5p).

Precursor miRNA

Precursor Name hsa-mir-15a
Genomic Location chr13:50049119-50049201 (-); nearby genomic features
Clustered miRNAs hsa-mir-16-1,hsa-mir-15a (within 10kb in genome)
NCBI GENE ID 406948
MIM ID 609703
miRBase ID MI0000069
Precursor Sequence 
     gaguaaa ua        ua          ga  u
ccuug       g  gcagcaca  augguuugug  uu u
|||||       |  ||||||||  ||||||||||  ||  g
ggaac       c  cgucgugu  uaccggacgu  aa a
     auaaaaa uc        ua          gg  a

References

  • miR-15a targets the HSP90 co-chaperone Morgana in chronic myeloid leukemia. Poggio P, Rocca S, Fusella F, Ferretti R, Ala U, D'Anna F, Giugliano E, Panuzzo C, Fontana D, Palumbo V, Carrà G, Taverna D, Gambacorti-Passerini C, Saglio G, Fava C, Piazza R, Morotti A, Orso F, Brancaccio M. Sci Rep. 2024 Jul 2;14(1):15089.

  • Evaluation of the expression level of microRNA-21, microRNA-15a, microRNA-372 in human follicular fluid stem cells-derived oocyte-like cells (OLCs). Saki G, Shahrooie K, Moghadam MT, Moghadam ARE, Nikbakht R. JBRA Assist Reprod. 2024 Jun 1;28(2):289-294.

  • microRNA-15a-5p suppresses hypoxia-induced tumor growth and chemoresistance in bladder cancer by binding to eIF5A2. Yang J, Xiang H, Cheng M, Jiang X, Chen Y, Zheng L, Yan S, Zhang S, Zhang C, Chen W, Chen D. Neoplasma. 2024 Feb;71(1):60-69.

  • Construction of a Fu C, Liu Y, Yang H, Liang Q, Liu W, Guo W. Ren Fail. 2024 Dec;46(1):2313175.

  • LncRNA PFAR facilitates the proliferation and migration of papillary thyroid carcinoma by competitively binding to miR-15a. Fang T, Yu K. Naunyn Schmiedebergs Arch Pharmacol. 2024 May;397(5):3037-3048.

  • Role of miR-15a-5p and miR-199a-3p in the inflammatory pathway regulated by NF-κB in experimental and human atherosclerosis. González-López P, Álvarez-Villarreal M, Ruiz-Simón R, López-Pastor AR, de Ceniga MV, Esparza L, Martín-Ventura JL, Escribano Ó, Gómez-Hernández A. Clin Transl Med. 2023 Aug;13(8):e1363.

  • MALAT1 regulates network of microRNA-15a/16-VEGFA to promote tumorigenesis and angiogenesis in multiple myeloma. Yan H, Gao S, Xu A, Zuo L, Zhang J, Zhao Y, Cheng Q, Yin X, Sun C, Hu Y. Carcinogenesis. 2023 Dec 15;44(10-11):760-772.

  • LncRNA-ZNF252P-AS1/miR-15b-5p promotes the proliferation of keloid fibroblast by regulating the BTF3-STAT3 signaling pathway. Guo Y, Li M, Long J, Fan P, Zuo C, Wang Y. J Dermatol Sci. 2022 Dec;108(3):146-156.

  • Hsa_circ_0006988 Promotes Sorafenib Resistance of Hepatocellular Carcinoma by Modulating IGF1 Using miR-15a-5p. Qiu R, Zeng Z. Can J Gastroenterol Hepatol. 2022 Dec 24;2022:1206134.

  • The Molecular Mechanisms and Function of miR-15a/16 Dysregulation in Fibrotic Diseases. Wen D, Zhang H, Zhou Y, Wang J. Int J Mol Sci. 2022 Dec 16;23(24):16041.

  • miR-15a-5p enhances the malignant phenotypes of colorectal cancer cells through the STAT3/TWIST1 and PTEN/AKT signaling pathways by targeting SIRT4. Deng J, Wang H, Liang Y, Zhao L, Li Y, Yan Y, Zhao H, Zhang X, Zou F. Cell Signal. 2023 Jan;101:110517.

  • MicroRNA-15 suppresses viability, migration and invasion of the human MG-63 osteosarcoma cells via inhibition of cyclin dependent kinase 6 (CDK6). Shen Z, Wang C, Liu B, Du J, Li Z, Zhao J. Acta Biochim Pol. 2022 Oct 22;69(4):761-766.

  • A miR-15a related polymorphism affects NSCLC prognosis via altering ERCC1 repair to platinum-based chemotherapy. Xue P, Zhang G, Zhang H, Cui S, Zhang L, Yu T, Xiao M, Li L, Lu X. J Cell Mol Med. 2022 Nov;26(21):5439-5451.

  • miR-15a-5p Regulates Liver Cancer Cell Migration, Apoptosis and Cell Cycle Progression by Targeting Transcription Factor E2F3. Li Y, Li D, Yang Y, Wang J. Crit Rev Eukaryot Gene Expr. 2022;32(6):1-10.

  • The minor allele of rs17427875 in long non-coding RNA-HOXA11-AS influences the prognosis of subarachnoid hemorrhage (SAH) via modulating miR-15a and STAT3 expression. Zhou Y, Xu Z, Li S. Aging (Albany NY). 2022 Jun 14;14(12):5075-5085.

  • Analysis of miR-375-3p, miR-197-3p, and miR-15a-5p Expression and Their Clinical Relevance as Biomarkers in Lung Cancer. Kumar S, Saikia J, Sharawat SK, Malik PS, Kumar S, Mohan A. Technol Cancer Res Treat. 2022 Jan-Dec;21:15330338221080981.

  • Human umbilical cord-mesenchymal stem cells-derived exosomes carrying microRNA-15a-5p possess therapeutic effects on Wilms tumor via regulating septin 2. Huang H, Zhong P, Zhang J, Chen X, Chen J, Lin T, Wu Q. Bioengineered. 2022 Mar;13(3):6136-6149.

  • A large fraction of trisomy 12, 17p Pepe F, Rassenti LZ, Pekarsky Y, Labanowska J, Nakamura T, Nigita G, Kipps TJ, Balatti V, Croce CM. Proc Natl Acad Sci U S A. 2022 Jan 25;119(4):e2118752119.

  • PDCD1 (PD-1) is a direct target of miR-15a-5p and miR-16-5p. Palamarchuk A, Tsyba L, Tomasello L, Pekarsky Y, Croce CM. Signal Transduct Target Ther. 2022 Jan 19;7(1):12.

  • MicroRNA-15a-5p acts as a tumor suppressor in histiocytosis by mediating CXCL10-ERK-LIN28a-let-7 axis. Weissman R, Diamond EL, Haroche J, Durham BH, Cohen F, Buthorn J, Amoura Z, Emile JF, Mazor RD, Shomron N, Abdel-Wahab OI, Shpilberg O, Hershkovitz-Rokah O. Leukemia. 2022 Apr;36(4):1139-1149.

    • There are 250 references associated with hsa-miR-15a-5p. Click here to see the complete list in PubMed.