Mature miRNA: hsa-miR-1587

Mature miRNA

miRNA Name hsa-miR-1587
miRNA Sequence 5' - uugggcugggcuggguuggg - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019077
Similar miRNAs hsa-miR-3620-5p (sharing the same seed sequence with hsa-miR-1587).

Precursor miRNA

Precursor Name hsa-mir-1587
Genomic Location chrX:39837561-39837613 (+); nearby genomic features
NCBI GENE ID 100616251
miRBase ID MI0016905
Precursor Sequence 
u    -gc    c      g     u
 uugg   uggg uggguu ggcag u
 ||||   |||| |||||| |||||  c
 gacc   gucc acucag ucguc u
c    agu    -      g     u

References

  • Exploration of the Hsa-miR-1587-Protein Interaction and the Inhibition to CASK. Zhang L, Zhou J, Xu M, Yuan G. Int J Mol Sci. 2021 Oct 3;22(19):10716.

  • M2 macrophages contribute to cell proliferation and migration of breast cancer. Tu D, Dou J, Wang M, Zhuang H, Zhang X. Cell Biol Int. 2021 Apr;45(4):831-838.

  • BTXA regulates the epithelial-mesenchymal transition and autophagy of keloid fibroblasts via modulating miR-1587/miR-2392 targeted ZEB2. Hou Z, Fan F, Liu P. Biosci Rep. 2019 Oct 30;39(10):BSR20190679.

  • Exosomes from Glioma-Associated Mesenchymal Stem Cells Increase the Tumorigenicity of Glioma Stem-like Cells via Transfer of miR-1587. Figueroa J, Phillips LM, Shahar T, Hossain A, Gumin J, Kim H, Bean AJ, Calin GA, Fueyo J, Walters ET, Kalluri R, Verhaak RG, Lang FF. Cancer Res. 2017 Nov 1;77(21):5808-5819.

  • Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A, Dave SS; Hematologic Malignancies Research Consortium. Blood. 2010 Dec 2;116(23):e118-27.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.