Mature miRNA: hsa-miR-155-3p

Mature miRNA

miRNA Name hsa-miR-155-3p
Previous Name hsa-miR-155*
miRNA Sequence 5' - cuccuacauauuagcauuaaca - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004658

Precursor miRNA

Precursor Name hsa-mir-155
Genomic Location chr21:25573980-25574044 (+); nearby genomic features
NCBI GENE ID 406947
MIM ID 609337
miRBase ID MI0000681
Precursor Sequence 
              c   a        -u   c
cuguuaaugcuaau gug uagggguu  uug c
|||||||||||||| ||| ||||||||  ||| 
gacaauuacgauua uac auccucag  aac u
              -   -        uc   c

References

  • The simultaneous miR-155-5p overexpression and miR-223-3p inhibition can activate pEMT in oral squamous cell carcinoma. Zhou R, Chen Z, Cai Y, Zhang H, Mao S, Zhuang Y, Zheng J. J Appl Oral Sci. 2024 Oct 21;32:e20240215.

  • Expression of microRNA-155 in thalassemic erythropoiesis. Penglong T, Pholngam N, Tehyoh N, Tansila N, Buncherd H, Thanapongpichat S, Srinoun K. PeerJ. 2024 Sep 20;12:e18054.

  • Exosomal miR-155-5p drives ibrutinib resistance in B-cell lymphoma. Park B, Choi ME, Ryu KJ, Park C, Choi M, Yoon SE, Kim WS, Kim HH, Hong JY, Kim SJ. Exp Cell Res. 2024 Oct 1;442(2):114248.

  • miR‑155 promotes an inflammatory response in HaCaT cells via the IRF2BP2/KLF2/NF‑κB pathway in psoriasis. Chen L, Liu C, Xiang X, Qiu W, Guo K. Int J Mol Med. 2024 Nov;54(5):91.

  • Inflammatory factor-mediated miR-155/SOCS1 signaling axis leads to Treg impairment in systemic lupus erythematosus. Yu J, Mei J, Zuo D, Zhang M, Yu S, Li F, Wang J, Bi D, Ma S, Wang J, Yin ZJ. Int Immunopharmacol. 2024 Nov 15;141:113013.

  • Serum microRNAs as new biomarkers for detecting subclinical hemolysis in the nonacute phase of G6PD deficiency. Boonpeng K, Shibuta T, Hirooka Y, Kulkeaw K, Palasuwan D, Umemura T. Sci Rep. 2024 Jul 11;14(1):16029.

  • miR-155 promotes Th17 differentiation by targeting FOXP3 to aggravate inflammation in MRSA pneumonia. Tian K, Xu W, Chen M, Deng F. Cytokine. 2024 Aug;180:156662.

  • circ_0000592 facilitates the progression of esophageal squamous cell carcinoma via miR-155-5p/FZD5 axis. He J, Yu K, Liang G, Shen W, Tian H. J Biochem Mol Toxicol. 2024 Jun;38(6):e23742.

  • The impact of miRNA-155 in acute and chronic toxoplasmosis in Iraqi women. Qassim HA, Mohammed ST, Muhamed HJ. Acta Trop. 2024 Jul;255:107211.

  • [Correlation of Wang LY, Jiang PF, Li JZ, Chen YX, Hu JD. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2024 Apr;32(2):395-401.

  • ORF3a of SARS-CoV-2 modulates PI3K/AKT signaling in human lung epithelial cells via hsa-miR-155-5p. Ahmad F, Keshri V, Singh SK. Int J Biol Macromol. 2024 May;268(Pt 1):131734.

  • MicroRNA-155 and exosomal microRNA-155: Small pieces in the cardiovascular diseases puzzle. Eshraghi R, Rafiei M, Hadian Jazi Z, Shafie D, Raisi A, Mirzaei H. Pathol Res Pract. 2024 May;257:155274.

  • The PIEZO1/miR-155-5p/GDF6/SMAD2/3 signaling axis is involved in inducing the occurrence and progression of osteoarthritis under excessive mechanical stress. Qin C, Feng Y, Yin Z, Wang C, Yin R, Li Y, Chen K, Tao T, Zhang K, Jiang Y, Gui J. Cell Signal. 2024 Jun;118:111142.

  • Exploring miR-155-5p and miR-1246 as Diagnostic and Prognostic Markers in Oral Squamous cell carcinoma. Maheswari R, Urs AB, Kumar P, Koner BC, Guru SA, Rawat G. Mol Biol Rep. 2024 Feb 24;51(1):341.

  • Differential Expression of MicroRNA MiR-145 and MiR-155 Downstream Targets in Oral Cancers Exhibiting Limited Chemotherapy Resistance. Belnap C, Divis T, Kingsley K, Howard KM. Int J Mol Sci. 2024 Feb 10;25(4):2167.

  • MiR-155-5p improves the insulin sensitivity of trophoblasts by targeting CEBPB in gestational diabetes mellitus. Zhang H, Jiang Y, Zhu S, Wei L, Zhou X, Gao P, Zhang J, Chen Y, Du Y, Fang C, Su R, Li J, Wang S, Feng L. Placenta. 2024 Mar 25;148:1-11.

  • Low expression levels of miRNA-155 and miRNA-499a are associated with obesity in Type 2 diabetes. Latini A, Benedittis G, Ciccacci C, Novelli G, Spallone V, Borgiani P. Epigenomics. 2024 Jan;16(2):85-91.

  • The impact of MicroRNA-155 on the effect of cryoablation in paroxysmal atrial fibrillation. He W, Tang R, Han J, Zhang Z, Li J, Xue W, Xie Q. Cell Mol Biol (Noisy-le-grand). 2023 Nov 30;69(12):144-149.

  • Hypoxia-inducible microRNA-155 negatively regulates epithelial barrier in eosinophilic esophagitis by suppressing tight junction claudin-7. Markey GE, Ryan S, Furuta GT, Menard-Katcher C, McNamee EN, Masterson JC. FASEB J. 2024 Jan;38(1):e23358.

  • MiR-155 Negatively Regulates Anti-Viral Innate Responses among HIV-Infected Progressors. Pawar P, Gokavi J, Wakhare S, Bagul R, Ghule U, Khan I, Ganu V, Mukherjee A, Shete A, Rao A, Saxena V. Viruses. 2023 Nov 1;15(11):2206.

    • There are 925 references associated with hsa-miR-155-3p. Click here to see the complete list in PubMed.