Mature miRNA: hsa-miR-134-5p

Mature miRNA

miRNA Name hsa-miR-134-5p
miRNA Sequence 5' - ugugacugguugaccagagggg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000447
Similar miRNAs hsa-miR-3118 (sharing the same seed sequence with hsa-miR-134-5p).

Precursor miRNA

Precursor Name hsa-mir-134
Genomic Location chr14:101054687-101054759 (+); nearby genomic features
Clustered miRNAs hsa-mir-381,hsa-mir-487b,hsa-mir-539,hsa-mir-889,hsa-mir-544a,hsa-mir-655,hsa-mir-487a,hsa-mir-382,hsa-mir-134,hsa-mir-668,hsa-mir-485,hsa-mir-323b,hsa-mir-154,hsa-mir-496,hsa-mir-377,hsa-mir-541 (within 10kb in genome)
NCBI GENE ID 406924
MIM ID 610164
miRBase ID MI0000474
Precursor Sequence 
c     gu        u  -a   g    ---    g
 agggu  gugacugg ug  cca aggg   gcau c
 |||||  |||||||| ||  ||| ||||   ||||  a
 uccca  cacugauc ac  ggu uccc   ugug c
c     ac        c  cg   g    acu    u

References

  • circ_0029463 promotes osteoclast differentiation by mediating miR-134-5p/Rab27a axis. Tang L, Yuan L, Yan J, Ge J, Lian Z, Li Z. J Orthop Surg Res. 2024 Feb 7;19(1):128.

  • LncRNA TDRKH-AS1 promotes breast cancer progression via the miR-134-5p/CREB1 axis. Ding Y, Huang Y, Zhang F, Gong L, Liang C, Ding K, He X, Ding X, Chen Y. J Transl Med. 2023 Nov 26;21(1):854.

  • Deciphering the neural mechanisms of miR-134 in major depressive disorder with population-based and person-specific imaging transcriptomic techniques. Lou J, Liu K, Wen J, He Y, Sun Y, Tian X, Hu K, Deng Y, Liu B, Wen G. Psychiatry Res. 2023 Nov;329:115551.

  • HDAC4 regulates the proliferation, migration, and invasion of trophoblasts in pre-eclampsia through the miR-134-5p/FOXM1 axis. Xu Y, Kang X, Jiang H, Liu H, Wang W. Mol Reprod Dev. 2023 Dec;90(12):849-860.

  • Long noncoding RNA PPP1R14B-AS1 imitates microRNA-134-3p to facilitate breast cancer progression by upregulating LIM and SH3 protein 1. Zhou L, Zhang L, Guan X, Dong YI, Liu T. Oncol Res. 2022 Aug 31;29(4):251-262.

  • Decreased Serum Exosomal microRNA-134 Expression and Its Prognostic Value in Gastric Cancer. Jin Z, Song Y, Lian C, Gao L. Ann Clin Lab Sci. 2022 Jul;52(4):563-570.

  • Long non‑coding RNA PCAT1 sponges miR‑134‑3p to regulate PITX2 expression in breast cancer. Tang W, Lu G, Ji Y, Xu Y. Mol Med Rep. 2022 Mar;25(3):75.

  • LncRNA JHDM1D-AS1 Suppresses MPP + -Induced Neuronal Injury in Parkinson's Disease via miR-134-5p/PIK3R3 Axis. Wang C, Zhang H, Li J. Neurotox Res. 2021 Dec;39(6):1771-1781.

  • CircPTK2 inhibits the tumorigenesis and metastasis of gastric cancer by sponging miR-134-5p and activating CELF2/PTEN signaling. Fan HN, Zhao XY, Liang R, Chen XY, Zhang J, Chen NW, Zhu JS. Pathol Res Pract. 2021 Nov;227:153615.

  • Expression profiles of miR-196, miR-132, miR-146a, and miR-134 in human colorectal cancer tissues in accordance with their clinical significance : Comparison regarding KRAS mutation. Maralani M, Shanehbandi D, Asadi M, Hashemzadeh S, Hajiasgharzadeh K, Mashhadi Abdolahi H, Baradaran B, Peeters M. Wien Klin Wochenschr. 2021 Nov;133(21-22):1162-1170.

  • Long noncoding RNA LINC00858 promotes the progression of ovarian cancer via regulating the miR-134-5p/TRIM44 axis. Li P, Huang G. J Recept Signal Transduct Res. 2022 Aug;42(4):382-389.

  • Exosome miR-134-5p restrains breast cancer progression via regulating PI3K/AKT pathway by targeting ARHGAP1. Yang C, Zhang G, Zhang Y, Zhang S, Li J, Liu Y. J Obstet Gynaecol Res. 2021 Nov;47(11):4037-4048.

  • Long non-coding RNA KCNQ1OT1 promotes proliferation, migration and invasion via targeting miR-134 in retinoblastoma. Wang L, Yi S, Wang R, Wang J. J Gene Med. 2021 Jun;23(6):e3336.

  • miRNAs derived from circulating small extracellular vesicles as diagnostic biomarkers for nasopharyngeal carcinoma. Jiang L, Zhang Y, Li B, Kang M, Yang Z, Lin C, Hu K, Wei Z, Xu M, Mi J, Wang R, Wu F. Cancer Sci. 2021 Jun;112(6):2393-2404.

  • Transcription factor ELK1 accelerates aerobic glycolysis to enhance osteosarcoma chemoresistance through miR-134/PTBP1 signaling cascade. Zhang Q, Wu J, Zhang X, Cao L, Wu Y, Miao X. Aging (Albany NY). 2021 Feb 17;13(5):6804-6819.

  • The Predictive Value of miR-16, -29a and -134 for Early Identification of Gestational Diabetes: A Nested Analysis of the DALI Cohort. Sørensen AE, van Poppel MNM, Desoye G, Damm P, Simmons D, Jensen DM, Dalgaard LT; The DALI Core Investigator Group. Cells. 2021 Jan 15;10(1):170.

  • Silencing of Long Non-coding RNA TTN-AS1 Inhibits Hepatocellular Carcinoma Progression by the MicroRNA-134/ITGB1 Axis. Huang Y, Chu P, Bao G. Dig Dis Sci. 2021 Nov;66(11):3916-3928.

  • SDF-1α/MicroRNA-134 Axis Regulates Nonfunctioning Pituitary Neuroendocrine Tumor Growth Wang X, Fang Y, Zhou Y, Guo X, Xu K, Li C, Zhang J, Hong Y. Front Endocrinol (Lausanne). 2020 Dec 9;11:566761.

  • miR-96-5p, miR-134-5p, miR-181b-5p and miR-200b-3p heterogenous expression in sites of prostate cancer versus benign prostate hyperplasia-archival samples study. PeÅ‚ka K, Klicka K, Grzywa TM, Gondek A, Marczewska JM, Garbicz F, Szczepaniak K, Paskal W, WÅ‚odarski PK. Histochem Cell Biol. 2021 Mar;155(3):423-433.

  • MicroRNA-134-3p inhibits ovarian cancer progression by targeting flap structure-specific endonuclease 1 in vitro. Zhao M, Ji H, Fu Q, Cheng Q, Zhang Y, Yang Y. Oncol Rep. 2021 Jan;45(1):119-128.

    • There are 95 references associated with hsa-miR-134-5p. Click here to see the complete list in PubMed.