Mature miRNA: hsa-miR-1285-5p

Mature miRNA

miRNA Name hsa-miR-1285-5p
miRNA Sequence 5' - gaucucacuuuguugcccagg - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0022719

Precursor miRNA

Precursor Name hsa-mir-1285-1
Genomic Location chr7:92204015-92204098 (-); nearby genomic features
NCBI GENE ID 100302218
miRBase ID MI0006346
Precursor Sequence 
--            a                    ug ucuc
  uguagagauagg ucucacuuuguugcccaggc  g    a
  |||||||||||| ||||||||||||||||||||  |    
  acaucucuauuc agagugaaacaacgggucug  c    a
ga            c                    gu cuca

References

  • Repression of Smad4 by MicroRNA-1285 moderates TGF-β-induced epithelial-mesenchymal transition in proliferative vitreoretinopathy. Pao SI, Lin LT, Chen YH, Chen CL, Chen JT. PLoS One. 2021 Aug 12;16(8):e0254873.

  • Circular RNA hsa_circ_0000376 Participates in Tumorigenesis of Breast Cancer by Targeting miR-1285-3p. Peng Z, Xu B, Jin F. Technol Cancer Res Treat. 2020 Jan-Dec;19:1533033820928471.

  • MiR-1285-5p/TMEM194A axis affects cell proliferation in breast cancer. Hironaka-Mitsuhashi A, Otsuka K, Gailhouste L, Sanchez Calle A, Kumazaki M, Yamamoto Y, Fujiwara Y, Ochiya T. Cancer Sci. 2020 Feb;111(2):395-405.

  • Methylation dependent microRNA 1285-5p and sterol carrier proteins 2 in type 2 diabetes mellitus. Bai L, Li J, Panagal M, M B, Sekar D. Artif Cells Nanomed Biotechnol. 2019 Dec;47(1):3417-3422.

  • miR-1285-3p is a potential prognostic marker in human osteosarcoma and functions as a tumor suppressor by targeting YAP1. Hu XH, Dai J, Shang HL, Zhao ZX, Hao YD. Cancer Biomark. 2019;25(1):1-10.

  • MicroRNA-1285-5p influences the proliferation and metastasis of non-small-cell lung carcinoma cells via downregulating CDH1 and Smad4. Zhou S, Zhang Z, Zheng P, Zhao W, Han N. Tumour Biol. 2017 Jun;39(6):1010428317705513.

  • MicroRNA-1285 inhibits malignant biological behaviors of human pancreatic cancer cells by negative regulation of YAP1. Huang H, Xiong G, Shen P, Cao Z, Zheng L, Zhang T, Zhao Y. Neoplasma. 2017;64(3):358-366.

  • Plasma miR-324-3p and miR-1285 as diagnostic and prognostic biomarkers for early stage lung squamous cell carcinoma. Gao X, Wang Y, Zhao H, Wei F, Zhang X, Su Y, Wang C, Li H, Ren X. Oncotarget. 2016 Sep 13;7(37):59664-59675.

  • Identification of cardiac-related circulating microRNA profile in human chronic heart failure. Li H, Fan J, Yin Z, Wang F, Chen C, Wang DW. Oncotarget. 2016 Jan 5;7(1):33-45.

  • miR-1285-3p acts as a potential tumor suppressor miRNA via downregulating JUN expression in hepatocellular carcinoma. Liu J, Yan J, Zhou C, Ma Q, Jin Q, Yang Z. Tumour Biol. 2015 Jan;36(1):219-25.

  • Tumor suppressive microRNA-1285 regulates novel molecular targets: aberrant expression and functional significance in renal cell carcinoma. Hidaka H, Seki N, Yoshino H, Yamasaki T, Yamada Y, Nohata N, Fuse M, Nakagawa M, Enokida H. Oncotarget. 2012 Jan;3(1):44-57.

  • Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA. Genome Res. 2008 Apr;18(4):610-21.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.