Mature miRNA: hsa-miR-1272



Mature miRNA

miRNA Name hsa-miR-1272
miRNA Sequence 5' - gaugaugauggcagcaaauucugaaa - 3' (length = 26)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005925

Precursor miRNA

Precursor Name hsa-mir-1272
Genomic Location chr15:64762387-64762515 (-); nearby genomic features
NCBI GENE ID 100302184
miRBase ID MI0006408
Precursor Sequence
--    au      --u   ug g    u aug     ---a a      --aa   u   cagug    ua
  ccag  cagauc   ggg  c auga g   gcagc    a uucuga    acg gcu     ucuu  u
  ||||  ||||||   |||  | |||| |   |||||    | ||||||    ||| |||     ||||  
  gguc  gucugg   cuc  g ugcu c   cgucg    u aagauu    ugc cga     agga  a
au    gg      ugu   gu -    - -ga     gaug a      caaa   -   ----a    ca

References


  • miR-515-3p, miR-623, miR-1272 and Notch3 protein as new biomarkers of Hepatocellular carcinoma. Asefy Z, Hoseinnejhad S, Eftekhari A, Shoukuhi B. Horm Mol Biol Clin Investig. 2021 Dec 22;43(2):193-198.

  • The emerging role of the MiR-1272-ADAM9-CDCP1 signaling pathway in the progression of glioma. Geng F, Lu GF, Luo YJ, Dominguez S, Kong DY, Shen LH, Luo XM, Yang X, Hu M, Lai WS, Jiang ZS, Chen YS. Aging (Albany NY). 2020 Nov 26;13(1):894-909.

  • miR-1272 Rotundo F, Cominetti D, El Bezawy R, Percio S, Doldi V, Tortoreto M, Zuco V, Valdagni R, Zaffaroni N, Gandellini P. Cells. 2020 Feb 13;9(2):435.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA. Genome Res. 2008 Apr;18(4):610-21.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.