Mature miRNA: hsa-miR-1245b-5p

Mature miRNA

miRNA Name hsa-miR-1245b-5p
miRNA Sequence 5' - uaggccuuuagaucacuuaaa - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019950
Similar miRNAs hsa-miR-3142 (sharing the same seed sequence with hsa-miR-1245b-5p).

Precursor miRNA

Precursor Name hsa-mir-1245b
Genomic Location chr2:188978093-188978161 (-); nearby genomic features
Clustered miRNAs hsa-mir-1245a,hsa-mir-1245b (within 10kb in genome)
NCBI GENE ID 100616324
miRBase ID MI0017431
Precursor Sequence 
u    a                 -  uaaa  -  a
 uuau uguaggccuuuagauca cu    ga gu u
 |||| ||||||||||||||||| ||    || ||  u
 aaua auauccggaaaucuagu ga    cu ca c
a    c                 a  ----  a  a

References

  • Deregulation of miR-1245b-5p and miR-92a-3p and their potential target gene, GATA3, in epithelial-mesenchymal transition pathway in breast cancer. Yadollahi Farsani M, Amini Farsani Z, Teimuri S, Kolahdouzan M, Eshraghi Samani R, Teimori H. Cancer Rep (Hoboken). 2024 Feb;7(2):e1955.

  • Long non-coding RNA HCG11 enhances osteosarcoma phenotypes by sponging miR-1245b-5p that directly inhibits plakophilin 2. Yan H, Zhou Y, Chen Z, Yan X, Zhu L. Bioengineered. 2022 Jan;13(1):140-154.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.