Mature miRNA: hsa-miR-1243

Mature miRNA

miRNA Name hsa-miR-1243
miRNA Sequence 5' - aacuggaucaauuauaggagug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005894

Precursor miRNA

Precursor Name hsa-mir-1243
Genomic Location chr4:113106863-113106955 (+); nearby genomic features
NCBI GENE ID 100302188
miRBase ID MI0006373
Precursor Sequence 
-------c     c     ca     ag   ug  a   -----    cca
        uaaaa uggau  auuau  gag  aa uaa     aggu   u
        ||||| |||||  |||||  |||  || |||     ||||    c
        auuuu aucua  uaaug  uuc  uu auu     uccg   u
ccaagaaa     u     aa     gu   gu  c   auuua    ucc

References

  • Hsa_circ_0043265 Restrains Cell Proliferation, Migration and Invasion of Tongue Squamous Cell Carcinoma via Targeting the miR-1243/SALL1 Axis. Qian C, Yang Y, Lan T, Wang Y, Yao J. Pathol Oncol Res. 2021 Feb 3;27:587130.

  • miR-509-5p and miR-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer. Hiramoto H, Muramatsu T, Ichikawa D, Tanimoto K, Yasukawa S, Otsuji E, Inazawa J. Sci Rep. 2017 Jun 21;7(1):4002.

  • Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA. Genome Res. 2008 Apr;18(4):610-21.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.