Mature miRNA: hsa-miR-1231

Mature miRNA

miRNA Name hsa-miR-1231
miRNA Sequence 5' - gugucugggcggacagcugc - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005586

Precursor miRNA

Precursor Name hsa-mir-1231
Genomic Location chr1:201808611-201808702 (+); nearby genomic features
NCBI GENE ID 100302158
MIM ID 617040
miRBase ID MI0006321
Precursor Sequence 
gucagugu   -   --      cu     aa    ---a    ---ca    u
        cug ggc  ggacag  gcagg  aggg    agac     aggc u
        ||| |||  ||||||  |||||  ||||    ||||     ||||  g
        gac ccg  cuuguc  ugucc  uccc    ucug     ucug c
--------   a   uu      --     ca    accg    accug    u

References

  • Upregulated circ_0002141 facilitates oral squamous cell carcinoma progression via the miR-1231/EGFR axis. Wangzhou K, Lu Z, Lai Z, Fu W, Liu C, Tan Y, Hao C. Oral Dis. 2023 Apr;29(3):902-912.

  • Circular RNA circKIF4A facilitates the malignant progression and suppresses ferroptosis by sponging miR-1231 and upregulating GPX4 in papillary thyroid cancer. Chen W, Fu J, Chen Y, Li Y, Ning L, Huang D, Yan S, Zhang Q. Aging (Albany NY). 2021 Jun 21;13(12):16500-16512.

  • Circular RNA hsa_Circ_0005795 mediates cell proliferation of cutaneous basal cell carcinoma via sponging miR-1231. Li Y, Li Y, Li L. Arch Dermatol Res. 2021 Nov;313(9):773-782.

  • MiR-1231 enhances docetaxel sensitivity to gallbladder carcinoma cells by downregulating FOXC2. Gong YQ, Ni JL, Fang Q, Li T. Eur Rev Med Pharmacol Sci. 2020 Dec;24(23):12116-12123.

  • MiR-1231 correlates tumor prognosis and inhibits cell growth in ovarian cancer. Xie JR, Jiang YY, Xu W, Tao JZ. Eur Rev Med Pharmacol Sci. 2020 Aug;24(16):8308-8313.

  • miR-1231 Is Downregulated in Prostate Cancer with Prognostic and Functional Implications. Wang Y, Zhang Q, Guo B, Feng J, Zhao D. Oncol Res Treat. 2020;43(3):78-86.

  • Comprehensive circular RNA profiling reveals the regulatory role of the hsa_circ_0137606/miR‑1231 pathway in bladder cancer progression. Li W, Li Y, Sun Z, Zhou J, Cao Y, Ma W, Xie K, Yan X. Int J Mol Med. 2019 Nov;44(5):1719-1728.

  • Enhanced expression of circular RNA circ-DCAF6 predicts adverse prognosis and promotes cell progression via sponging miR-1231 and miR-1256 in gastric cancer. Wu L, Liu D, Yang Y. Exp Mol Pathol. 2019 Oct;110:104273.

  • Upregulated circular RNA circ_0025033 promotes papillary thyroid cancer cell proliferation and invasion via sponging miR-1231 and miR-1304. Pan Y, Xu T, Liu Y, Li W, Zhang W. Biochem Biophys Res Commun. 2019 Mar 5;510(2):334-338.

  • [Clinical significance of exosomal miR-1231 in pancreatic cancer]. Chen SL, Ma M, Yan L, Xiong SH, Liu Z, Li S, Liu T, Shang S, Zhang YY, Zeng H, Xie HL, Zuo CH. Zhonghua Zhong Liu Za Zhi. 2019 Jan 23;41(1):46-49.

  • Low expression of miR-1231 in patients with glioma and its prognostic significance. Wang H, Wu J, Luo WJ, Hu JL. Eur Rev Med Pharmacol Sci. 2018 Dec;22(23):8399-8405.

  • MicroRNA-1231 exerts a tumor suppressor role through regulating the EGFR/PI3K/AKT axis in glioma. Zhang J, Zhang J, Qiu W, Zhang J, Li Y, Kong E, Lu A, Xu J, Lu X. J Neurooncol. 2018 Sep;139(3):547-562.

  • Human microRNA hsa-miR-1231 suppresses hepatitis B virus replication by targeting core mRNA. Kohno T, Tsuge M, Murakami E, Hiraga N, Abe H, Miki D, Imamura M, Ochi H, Hayes CN, Chayama K. J Viral Hepat. 2014;21(9):e89-97.

  • A miR-1231 binding site polymorphism in the 3'UTR of IFNAR1 is associated with hepatocellular carcinoma susceptibility. Zhou C, Yu Q, Chen L, Wang J, Zheng S, Zhang J. Gene. 2012 Oct 1;507(1):95-8.

  • Mammalian mirtron genes. Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC. Mol Cell. 2007 Oct 26;28(2):328-36.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.