Mature miRNA: hsa-miR-1207-5p

Mature miRNA

miRNA Name hsa-miR-1207-5p
miRNA Sequence 5' - uggcagggaggcugggagggg - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005871
Similar miRNAs hsa-miR-4763-3p (sharing the same seed sequence with hsa-miR-1207-5p).

Precursor miRNA

Precursor Name hsa-mir-1207
Genomic Location chr8:128049152-128049238 (+); nearby genomic features
NCBI GENE ID 100302175
miRBase ID MI0006340
Precursor Sequence 
     ---    -gca      c  gga     ug     -    gg
gcagg   gcug    gggagg ug   ggggc  gcugg gucu  u
|||||   ||||    |||||| ||   |||||  ||||| ||||  
ugucu   cgac    uucuuu ac   ucccg  cgacu cggg  a
     uca    agaa      -  ---     gu     a    ug

References

  • Knockdown of LINC01138 protects human chondrocytes against IL-1β-induced damage by regulating the hsa-miR-1207-5p/KIAA0101 axis. Zhang J, Lv G. Immun Inflamm Dis. 2023 Jan;11(1):e744.

  • LncRNA PVT1 Regulates miR-1207-5p to Affect Colon Cancer Proliferation and Migration via the Wnt6/β-catenin2 Pathway. Yu P, Zhang J, Zhu A, Kong W, Shen X. Genet Test Mol Biomarkers. 2022 Jun;26(6):307-315.

  • Down-regulation of lncRNA LUADT1 suppresses cervical cancer cell growth by sequestering microRNA-1207-5p. Zhang Q, Zheng J, Liu L. Acta Biochim Biophys Sin (Shanghai). 2022 Mar 25;54(3):321-331.

  • Long non-coding RNA LUADT1 promotes nasopharyngeal carcinoma cell proliferation and invasion by downregulating miR-1207-5p. Jiang N, Zhao L, Zong D, Yin L, Wu L, Chen C, Song X, Zhang Q, Jiang X, He X, Feng J. Bioengineered. 2021 Dec;12(2):10716-10728.

  • MiR-1207-5p targets PYCR1 to inhibit the progression of prostate cancer. Xu H, He Y, Lin L, Li M, Zhou Z, Yang Y. Biochem Biophys Res Commun. 2021 Oct 20;575:56-64.

  • miR-1207-5p Can Contribute to Dysregulation of Inflammatory Response in COVID-19 Bertolazzi G, Cipollina C, Benos PV, Tumminello M, Coronnello C. Front Cell Infect Microbiol. 2020 Oct 29;10:586592.

  • Plasma microRNA-1207-5p as a Potential Biomarker for Diagnosis and Prognosis of Colorectal Cancer. Wang X, Li L, Xiao W, Xu Q. Clin Lab. 2020 Sep 1;66(9).

  • MiR-1207-5p/CX3CR1 axis regulates the progression of osteoarthritis via the modulation of the activity of NF-κB pathway. Liu XC, Xu L, Cai YL, Zheng ZY, Dai EN, Sun S. Int J Rheum Dis. 2020 Aug;23(8):1057-1065.

  • Characterization of antiapoptotic microRNAs in primary Sjögren's syndrome. Yang Y, Hou Y, Li J, Zhang F, Du Q. Cell Biochem Funct. 2020 Dec;38(8):1111-1118.

  • CircHIPK3 promotes colorectal cancer cells proliferation and metastasis via modulating of miR-1207-5p/FMNL2 signal. Yan Y, Su M, Qin B. Biochem Biophys Res Commun. 2020 Apr 16;524(4):839-846.

  • Correlation between miR-1207-5p expression with steroid-induced necrosis of femoral head and VEGF expression. Chao PC, Cui MY, Li XA, Jiang Y, Lin BC, Li ZB. Eur Rev Med Pharmacol Sci. 2019 Apr;23(7):2710-2718.

  • Long non-coding RNA 319 facilitates nasopharyngeal carcinoma carcinogenesis through regulation of miR-1207-5p/KLF12 axis. Song P, Yin SC. Gene. 2019 Jan 5;680:51-58.

  • Non-Coding RNA Pvt1 Promotes Cancer Stem Cell-Like Traits in Nasopharyngeal Cancer via Inhibiting miR-1207. Cui M, Chang Y, Fang QG, Du W, Wu JF, Wang JH, Liu ST, Luo SX. Pathol Oncol Res. 2019 Oct;25(4):1411-1422.

  • The Role of MicroRNA-1207-5p in Colorectal Cancer. Wang X, Wu X. Clin Lab. 2017 Nov 1;63(11):1875-1882.

  • The Tyr113His T/C rs1051740 and 'very slow' phenotype of the EPHX1 gene alters miR-26b-5p and miR-1207-5p expression in pregnancy. Naidoo P, Naidoo RN, Ramkaran P, Asharam K, Chuturgoon AA. Gene. 2017 Oct 30;633:71-81.

  • Differential Expression of microRNAs in Medulloblastoma and the Potential Functional Consequences. Zhang Y, Li L, Liang P, Zhai X, Li Y, Zhou Y. Turk Neurosurg. 2018;28(2):179-185.

  • PVT1-derived miR-1207-5p promotes breast cancer cell growth by targeting STAT6. Yan C, Chen Y, Kong W, Fu L, Liu Y, Yao Q, Yuan Y. Cancer Sci. 2017 May;108(5):868-876.

  • hnRNPK-regulated PTOV1-AS1 modulates heme oxygenase-1 expression via miR-1207-5p. Shin CH, Ryu S, Kim HH. BMB Rep. 2017 Apr;50(4):220-225.

  • miR-1207-3p regulates the androgen receptor in prostate cancer via FNDC1/fibronectin. Das DK, Naidoo M, Ilboudo A, Park JY, Ali T, Krampis K, Robinson BD, Osborne JR, Ogunwobi OO. Exp Cell Res. 2016 Nov 1;348(2):190-200.

  • MicroRNA-1207-5p inhibits hepatocellular carcinoma cell growth and invasion through the fatty acid synthase-mediated Akt/mTOR signalling pathway. Zhao G, Dong L, Shi H, Li H, Lu X, Guo X, Wang J. Oncol Rep. 2016 Sep;36(3):1709-16.

    • There are 29 references associated with hsa-miR-1207-5p. Click here to see the complete list in PubMed.