Mature miRNA: hsa-miR-1180-5p

Mature miRNA

miRNA Name hsa-miR-1180-5p
miRNA Sequence 5' - ggacccacccggccgggaaua - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0026735
Similar miRNAs hsa-miR-7114-3p (sharing the same seed sequence with hsa-miR-1180-5p).

Precursor miRNA

Precursor Name hsa-mir-1180
Genomic Location chr17:19344506-19344574 (-); nearby genomic features
NCBI GENE ID 100302256
miRBase ID MI0006273
Precursor Sequence 
        ---      c  -          gu  u
gcugcugg   acccac cg gccgggaaua  gc c
||||||||   |||||| || ||||||||||  ||  c
cggcggcu   ugggug gc cggccuuugu  ug u
        gug      c  u          --  g

References

  • Clinical significance of microRNA-1180-3p for colorectal cancer and effect of its alteration on cell function. Li C, Jin W, Zhang D, Tian S. Bioengineered. 2021 Dec;12(2):10491-10500.

  • Clinical significance of miR-1180-3p in hepatocellular carcinoma: a study based on bioinformatics analysis and RT-qPCR validation. Zhou Z, Zhou X, Jiang Y, Qiu M, Liang X, Lin Q, Guo Q, Nong C, Huo R, Chen Q, Liu H, Liu Y, Zhu S, Wang M, Yu H. Sci Rep. 2020 Jul 14;10(1):11573.

  • [Integrated analysis of DNA methylation and gene expression profiles of hepatocellular carcinoma to construct miR-1180-3p relevant ceRNA regulatory network]. Zhou ZH, Zhou XG, Zhou ZW, Qiu MQ, Jiang YJ, Lin QL, Liu YC, Wen QP, Huo RR, Liang XM, Yu HP. Zhonghua Gan Zang Bing Za Zhi. 2020 Jun 20;28(6):481-487.

  • MiR-1180 from bone marrow-derived mesenchymal stem cells induces glycolysis and chemoresistance in ovarian cancer cells by upregulating the Wnt signaling pathway. Gu ZW, He YF, Wang WJ, Tian Q, Di W. J Zhejiang Univ Sci B. 2019 Mar.;20(3):219-237.

  • The suppressive effects of miR-1180-5p on the proliferation and tumorigenicity of bladder cancer cells. Ge Q, Wang C, Chen Z, Li F, Hu J, Ye Z. Histol Histopathol. 2017 Jan;32(1):77-86.

  • MiR-1180 promoted the proliferation of hepatocellular carcinoma cells by repressing TNIP2 expression. Zhou X, Zhu HQ, Ma CQ, Li HG, Liu FF, Chang H, Lu J. Biomed Pharmacother. 2016 Apr;79:315-20.

  • MiR-1180 promotes apoptotic resistance to human hepatocellular carcinoma via activation of NF-κB signaling pathway. Tan G, Wu L, Tan J, Zhang B, Tai WC, Xiong S, Chen W, Yang J, Li H. Sci Rep. 2016 Mar 1;6:22328.

  • Birth and expression evolution of mammalian microRNA genes. Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H. Genome Res. 2013 Jan;23(1):34-45.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing. Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T. BMC Med Genomics. 2009 Jun 9;2:35.

  • MicroRNA expression signature of human sarcomas. Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M. Oncogene. 2008 Mar 27;27(14):2015-26.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.