Mature miRNA: hsa-miR-10a-3p

Mature miRNA

miRNA Name hsa-miR-10a-3p
Previous Name hsa-miR-10a*
miRNA Sequence 5' - caaauucguaucuaggggaaua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004555

Precursor miRNA

Precursor Name hsa-mir-10a
Genomic Location chr17:48579838-48579947 (-); nearby genomic features
NCBI GENE ID 406902
MIM ID 610173
miRBase ID MI0000266
Precursor Sequence 
-----gauc   --c    uu        a    g     c          uaaggaa
         ugu   uguc  cuguauau cccu uagau cgaauuugug       u
         |||   ||||  |||||||| |||| ||||| ||||||||||       
         aca   acag  gauguaua gggg aucua gcuuaaacac       u
ucucgccuc   aau    uu        a    -     u          ugguguu

References

  • Urinary microRNA-10a levels in diagnosis and prognosis of urinary bladder cancer. Zaidi N, Siddiqui Z, Sankhwar SN, Srivastava AN. J Cancer Res Ther. 2023 Jul-Sep;19(5):1324-1329.

  • Long noncoding RNA00324 is involved in the inflammation of rheumatoid arthritis by targeting miR-10a-5p via the NF-κB pathway. Xie B, Lin F, Bao W, Zhang Y, Liu Y, Li X, Hou W, Zeng Q. Immun Inflamm Dis. 2023 Jun;11(6):e906.

  • Expression and Correlation Research of MicroRNA10a-5p and PIK3CA in Middle Ear Cholesteatoma. Yang J, Yan W, Tang S, Huang Z, Ye M, Lu Z, Liu Q. J Int Adv Otol. 2023 Jun;19(3):212-216.

  • The long non-coding RNA KLF3-AS1/miR-10a-3p/ZBTB20 axis improves the degenerative changes in human nucleus pulposus cells. Chen S, Zhuang Q, Li P, Zeng J, Peng Y, Ding Z, Cao H, Zheng R, Wang W. Cell Tissue Res. 2023 Jul;393(1):97-109.

  • Upregulation of miRNA-10a-5p promotes tumor progression in cervical cancer by suppressing UBE2I signaling. Gu Y, Feng X, Jin Y, Liu Y, Zeng L, Zhou D, Feng Y. J Obstet Gynaecol. 2023 Dec;43(1):2171283.

  • LncRNA PCED1B-AS1 knockdown inhibits osteosarcoma via methylation-mediated miR-10a downregulation. Wang B, Yao L, Dong Y, Liu J, Wu J. J Orthop Surg Res. 2022 Oct 23;17(1):464.

  • LncRNA PCED1B-AS1 Upregulation in Hepatocellular Carcinoma and Regulation of the miR-10a/BCL6 Axis to Promote Cell Proliferation. Ding H, He J, Xiao W, Ren Z, Gao W. Crit Rev Eukaryot Gene Expr. 2022;32(6):11-20.

  • miR-10 and Its Negative Correlation with Serum IL-35 Concentration and Positive Correlation with STAT5a Expression in Patients with Rheumatoid Arthritis. Paradowska-Gorycka A, Wajda A, Rzeszotarska E, Kmiolek T, Stypinska B, Dudek E, Romanowska-Prochnicka K, Syrowka P. Int J Mol Sci. 2022 Jul 18;23(14):7925.

  • The Role, Significance, and Association of MicroRNA-10a/b in Physiology of Cancer. Elgeshy KM, Abdel Wahab AHA. Microrna. 2022;11(2):118-138.

  • Long non-coding RNA LINRIS is upregulated in non-small cell lung cancer and its silencing inhibits cell proliferation by suppressing microRNA-10a maturation. Zhu Y, Ma K, Ye Y, Tang J, Zhu J. Bioengineered. 2022 Feb;13(2):4340-4346.

  • CircRNA circSEPT9 Downregulates miR-10a through Methylation to Promote Cell Proliferation in Laryngeal Squamous Cell Carcinoma. Zhu M, Liu C, Chen S, Zhang C, Zhou P, Sun J, Zheng H. Crit Rev Eukaryot Gene Expr. 2021;31(6):17-22.

  • microRNA-10a-5p overexpression suppresses malignancy of colon cancer by regulating human liver cancer fibroblasts. Zheng X, Li JW, Liu YK, Ma YF, Gan JH, Han SG, Wang J, Wan ZY, Zhang J, Liu Y, Li YF, Zhang GL. Neoplasma. 2021 Nov;68(6):1157-1168.

  • Factor VIIa suppresses inflammation and barrier disruption through the release of EEVs and transfer of microRNA 10a. Das K, Keshava S, Pendurthi UR, Rao LVM. Blood. 2022 Jan 6;139(1):118-133.

  • The role of circulating blood microRNA-374 and microRNA-10 levels in the pathogenesis and therapeutic mechanisms of major depressive disorder. Liu W, Zhang F, Zheng Y, He S, Zhang T, Guo Q, Xu H, Chen H, Liu C, Yu S, Jiang K, Li H, Li G, Wang X, Liu X. Neurosci Lett. 2021 Oct 15;763:136184.

  • lncRNA GAS5 regulates angiogenesis by targeting miR‑10a‑3p/VEGFA in osteoporosis. Wu W, Li Q, Liu YF, Li Y. Mol Med Rep. 2021 Oct;24(4):711.

  • Roles of miR-10a-5p and miR-103a-3p, Regulators of BDNF Expression in Follicular Fluid, in the Outcomes of IVF-ET. Zhang Q, Su J, Kong W, Fang Z, Li Y, Huang Z, Wen J, Wang Y. Front Endocrinol (Lausanne). 2021 May 12;12:637384.

  • miRNA-10a-5p inhibits cell metastasis in hepatocellular carcinoma via targeting SKA1. Shen D, Zhao HY, Gu AD, Wu YW, Weng YH, Li SJ, Song JY, Gu XF, Qiu J, Zhao W. Kaohsiung J Med Sci. 2021 Sep;37(9):784-794.

  • MiR-10a in Pancreatic Juice as a Biomarker for Invasive Intraductal Papillary Mucinous Neoplasm by miRNA Sequencing. Kuratomi N, Takano S, Fukasawa M, Maekawa S, Kadokura M, Shindo H, Takahashi E, Hirose S, Fukasawa Y, Kawakami S, Hayakawa H, Takada H, Nakakuki N, Kato R, Yamaguchi T, Nakayama Y, Kawaida H, Kono H, Inoue T, Kondo T, Ichikawa D, Enomoto N. Int J Mol Sci. 2021 Mar 22;22(6):3221.

  • MicroRNA-10 negatively regulates inflammation in diabetic kidney via targeting activation of the NLRP3 inflammasome. Ding H, Li J, Li Y, Yang M, Nie S, Zhou M, Zhou Z, Yang X, Liu Y, Hou FF. Mol Ther. 2021 Jul 7;29(7):2308-2320.

  • MicroRNA-10a suppresses cell metastasis by targeting BDNF and predicted patients survival in renal cell carcinoma. Liu Y, Qi L, Zhang K, Wang F. J BUON. 2021 Jan-Feb;26(1):250-258.

    • There are 115 references associated with hsa-miR-10a-3p. Click here to see the complete list in PubMed.