Mature miRNA: hsa-miR-101-2-5p

Mature miRNA

miRNA Name hsa-miR-101-2-5p
miRNA Sequence 5' - ucgguuaucaugguaccgaugc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0037312

Precursor miRNA

Precursor Name hsa-mir-101-2
Genomic Location chr9:4850297-4850375 (+); nearby genomic features
NCBI GENE ID 406894
MIM ID 612512
miRBase ID MI0000739
Precursor Sequence 
  ug  c                    c a    guaua
ac  uc uuuuucgguuaucaugguac g ugcu     u
||  || |||||||||||||||||||| | ||||     
ug  gg aagaagucaauagugucaug c augg     c
  gu  u                    a -    aaagu

References

  • Unveiling the regulatory of miR-101-3p on ZNF746 in a Parkinson's disease cell model: Implications for therapeutic targeting. Mahmoudian Esfahani M, Mostashfi M, Vaheb Hosseinabadi S, Hashemi MS, Peymani M, Zohrabi D, Angaji SA, Nasr-Esfahani MH, Ghaedi K. Neurosci Res. 2024 Jun;203:18-27.

  • Up-regulation of microRNA 101-3p during erythropoiesis in β-thalassemia/HbE. Phannasil P, Sukhuma C, Nauphar D, Nuamsee K, Svasti S. Blood Cells Mol Dis. 2023 Nov;103:102781.

  • Investigating the expression level of miR-17-3p, miR-101-3p, miR-335-3p, and miR-296-3p in the peripheral blood of patients with acute myocardial infarction. Bakhshi A, Khani M, Alipour Parsa S, Khaheshi I, Namazi MH, Mazouri A, Bidram P, Safi M, Vakili H, Eslami V, Saadat H, Heidari L, Sohrabifar N. Mol Cell Biochem. 2024 Apr;479(4):859-868.

  • Investigating VEGF. miR-145-3p, and miR-101-3p Expression in Patients with Cholangiocarcinoma. Calastri MCJ, Ferreira RF, Tenani GD, Spinola LP, Vieira GF, Rabaça Roque Botelho MF, Abrantes AMC, Tralhão JGLR, De Brito AFM, Da Silva RF, Da Silva RCMA, Zanovelo EM, Da Costa LBE, Brito De Souza DC, Neto DS, Ferreira Boin IFS, Souza DRS. Asian Pac J Cancer Prev. 2022 Jul 1;23(7):2233-2241.

  • Long non-coding RNA LINC01347 suppresses trophoblast cell migration, invasion and EMT by regulating miR-101-3p/PTEN/AKT axis. Zhang X, Yan J, Dai Z, Long X, Jin J, Yang Q, Lin C, Yang Y, Chen Y, Zhu J. Reprod Biol. 2022 Sep;22(3):100670.

  • Transcription factor 3 (TCF3) combined with histone deacetylase 3 (HDAC3) down-regulates microRNA-101 to promote Burkitt lymphoma cell proliferation and inhibit apoptosis. Dong L, Huang J, Zu P, Liu J, Gao X, Du J, Li Y. Bioengineered. 2021 Dec;12(1):7995-8005.

  • Hypoxic stress suppresses lung tumor-secreted exosomal miR101 to activate macrophages and induce inflammation. Li J, Xu P, Wu D, Guan M, Weng X, Lu Y, Zeng Y, Chen R. Cell Death Dis. 2021 Aug 6;12(8):776.

  • miR-101-3p Serves as a Tumor Suppressor for Renal Cell Carcinoma and Inhibits Its Invasion and Metastasis by Targeting EZH2. Dong Y, Gao Y, Xie T, Liu H, Zhan X, Xu Y. Biomed Res Int. 2021 Jul 7;2021:9950749.

  • MicroRNA in combination with HER2-targeting drugs reduces breast cancer cell viability in vitro. Normann LS, Aure MR, Leivonen SK, Haugen MH, Hongisto V, Kristensen VN, Mælandsmo GM, Sahlberg KK. Sci Rep. 2021 May 25;11(1):10893.

  • Down-regulation of HCP5 inhibits cell proliferation, migration, and invasion through regulating EPHA7 by competitively binding miR-101 in osteosarcoma. Tu Y, Cai Q, Zhu X, Xu M. Braz J Med Biol Res. 2021 Jan 8;54(2):e9161.

  • miR-101-loaded exosomes secreted by bone marrow mesenchymal stem cells requires the FBXW7/HIF1α/FOXP3 axis, facilitating osteogenic differentiation. Li Y, Wang J, Ma Y, Du W, Feng K, Wang S. J Cell Physiol. 2021 Jun;236(6):4258-4272.

  • lncRNA SNHG1 attenuates osteogenic differentiation via the miR‑101/DKK1 axis in bone marrow mesenchymal stem cells. Xiang J, Fu HQ, Xu Z, Fan WJ, Liu F, Chen B. Mol Med Rep. 2020 Nov;22(5):3715-3722.

  • A novel regulatory loop miR-101/ANXA2/EGR1 mediates malignant characteristics of liver cancer stem cells. Ma S, Cheng J, Wang H, Ding N, Zhou F, Ji R, Zhu L, Zhu C, Pan Y. Carcinogenesis. 2021 Feb 11;42(1):93-104.

  • Long non-coding RNA DSCAM-AS1 upregulates Zhang S, Ding L, Gao F, Fan H. Biochem Cell Biol. 2020 Oct;98(5):600-611.

  • MiR-101 inhibits proliferation and invasion abilities of SKOV-3 ovarian cancer cells. Li Y, Li G, Wang X, Tang H, Geng N. Panminerva Med. 2022 Mar;64(1):122-123.

  • miR-101-3p and miR-199b-5p promote cell apoptosis in oral cancer by targeting BICC1. Wang H, Guo Y, Mi N, Zhou L. Mol Cell Probes. 2020 Aug;52:101567.

  • Long noncoding RNA CRNDE promotes proliferation, migration and invasion in prostate cancer through miR-101/Rap1A. Chen JH, Tong W, Pu XF, Wang JZ. Neoplasma. 2020 May;67(3):584-594.

  • Regulation of osteogenesis via miR-101-3p in mesenchymal stem cells by human gingival fibroblasts. Kaneda-Ikeda E, Iwata T, Mizuno N, Nagahara T, Kajiya M, Ouhara K, Yoshioka M, Ishida S, Kawaguchi H, Kurihara H. J Bone Miner Metab. 2020 Jul;38(4):442-455.

  • The upregulation of miR-101 promotes vascular endothelial cell apoptosis and suppresses cell migration in acute coronary syndrome by targeting CDH5. Cao S, Li L, Geng X, Ma Y, Huang X, Kang X. Int J Clin Exp Pathol. 2019 Sep 1;12(9):3320-3328. eCollection 2019.

  • MicroRNA-101-3p Downregulates TLR2 Expression, Leading to Reduction in Cytokine Production by Treponema pallidum-Stimulated Macrophages. Huang T, Yang J, Zhang J, Ke W, Zou F, Wan C, Wang L, Zhang X, Liang F, Mei S, Zhang Q, Rong Z, Yang B, Zheng H. J Invest Dermatol. 2020 Aug;140(8):1566-1575.e1.

    • There are 90 references associated with hsa-miR-101-2-5p. Click here to see the complete list in PubMed.